Information

Can a cell receive multiple copies of an insert when using different MOIs?

Can a cell receive multiple copies of an insert when using different MOIs?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

I want to transduce a cell line with virus that carries a specific insert.

When using different Multiplicity of Infection (MOI), I expect to get different percentage of transduced cells, but is it possible to get more than one insert integrated in the cell genome? I use high MOI and I always get 1 copy per cell, so I am not sure if increasing it a lot may also affect the number of in integrated inserts.


Yes, if you use a high enough MOI, you'll start to get double infections. Usually, anything >1 MOI will guarantee a high chance of double infections. If you're using a high MOI and only seeing single inserts, it might be due to your cells being difficult to transfect. If you look at this site: https://manuals.cellecta.com/lentiviral-construct-packaging-and-transduction/v10a/en/topic/lentiviral-titer-calculation it should give you a general reference for what % double transfected cells you should see. The difference between transfected cells and MOI % should estimate double infections assuming 100% efficiency.

Some cells are less efficient at being transfected, and it's a good idea to get a functional titer on your target cell line which is very easy if you have a fluorophore in the plasmid you're trying to insert.

I reread what you're getting at, and it's generally accepted that MOI under 0.4 won't give you double transfections.


A versatile one-step CRISPR-Cas9 based approach to plasmid-curing

Plasmids are widely used and essential tools in molecular biology. However, plasmids often impose a metabolic burden and are only temporarily useful for genetic engineering, bio-sensing and characterization purposes. While numerous techniques for genetic manipulation exist, a universal tool enabling rapid removal of plasmids from bacterial cells is lacking.

Results

Based on replicon abundance and sequence conservation analysis, we show that the vast majority of bacterial cloning and expression vectors share sequence similarities that allow for broad CRISPR-Cas9 targeting. We have constructed a universal plasmid-curing system (pFREE) and developed a one-step protocol and PCR procedure that allow for identification of plasmid-free clones within 24 h. While the context of the targeted replicons affects efficiency, we obtained curing efficiencies between 40 and 100% for the plasmids most widely used for expression and engineering purposes. By virtue of the CRISPR-Cas9 targeting, our platform is highly expandable and can be applied in a broad host context. We exemplify the wide applicability of our system in Gram-negative bacteria by demonstrating the successful application in both Escherichia coli and the promising cell factory chassis Pseudomonas putida.

Conclusion

As a fast and freely available plasmid-curing system, targeting virtually all vectors used for cloning and expression purposes, we believe that pFREE has the potential to eliminate the need for individualized vector suicide solutions in molecular biology. We envision the application of pFREE to be especially useful in methodologies involving multiple plasmids, used sequentially or simultaneously, which are becoming increasingly popular for genome editing or combinatorial pathway engineering.


Balanced Cellular and Humoral Immune Responses Targeting Multiple Antigens in Adults Receiving a Quadrivalent Inactivated Influenza Vaccine

A peer-reviewed article of this Preprint also exists.

Yu, E.D. Grifoni, A. Sutherland, A. Voic, H. Wang, E. Frazier, A. Jimenez-Truque, N. Yoder, S. Welsh, S. Wooden, S. Koff, W. Creech, B. Sette, A. da Silva Antunes, R. Balanced Cellular and Humoral Immune Responses Targeting Multiple Antigens in Adults Receiving a Quadrivalent Inactivated Influenza Vaccine. Vaccines 2021, 9, 426. Yu, E.D. Grifoni, A. Sutherland, A. Voic, H. Wang, E. Frazier, A. Jimenez-Truque, N. Yoder, S. Welsh, S. Wooden, S. Koff, W. Creech, B. Sette, A. da Silva Antunes, R. Balanced Cellular and Humoral Immune Responses Targeting Multiple Antigens in Adults Receiving a Quadrivalent Inactivated Influenza Vaccine. Vaccines 2021, 9, 426. Copy

Journal reference: Vaccines 2021, 9, 426
DOI: 10.3390/vaccines9050426

Cite as:

Yu, E.D. Grifoni, A. Sutherland, A. Voic, H. Wang, E. Frazier, A. Jimenez-Truque, N. Yoder, S. Welsh, S. Wooden, S. Koff, W. Creech, B. Sette, A. da Silva Antunes, R. Balanced Cellular and Humoral Immune Responses Targeting Multiple Antigens in Adults Receiving a Quadrivalent Inactivated Influenza Vaccine. Vaccines 2021, 9, 426. Yu, E.D. Grifoni, A. Sutherland, A. Voic, H. Wang, E. Frazier, A. Jimenez-Truque, N. Yoder, S. Welsh, S. Wooden, S. Koff, W. Creech, B. Sette, A. da Silva Antunes, R. Balanced Cellular and Humoral Immune Responses Targeting Multiple Antigens in Adults Receiving a Quadrivalent Inactivated Influenza Vaccine. Vaccines 2021, 9, 426. Copy


Gene Delivery Strategies

Biolistics

Biolistics , short for “biological ballistics” and also known as particle-mediated gene transfer, is the method of directly shooting DNA fragments into cells using a device called a gene gun.

To use a gene gun, a scientist first mixes a DNA construct with particles of a heavy metal, usually tungsten or gold. These fine particles stick to the negatively charged DNA. The DNA/metal particles are loaded onto one side of a plastic bullet ( Figure 11.4 ). A pressurized gas, usually helium, provides the force for the gun. Gas pressure builds up until a rupture disk breaks, driving the plastic bullet down a shaft. The plastic bullet is abruptly stopped at the end of the shaft, but the DNA/metal particles emerge from the gun with great speed and force. If the gun is aimed at biological tissue, some of the metal particles will penetrate the cell membranes and deliver DNA constructs to cells.

DNA-coated metal particles are placed on the front end of a bullet. High-pressured gas drives the bullet down a shaft. At the end of the shaft, the bullet is blocked, but the DNA-coated particles emerge with great speed and force.

A neuroscientist can use biolistic technology to cause efficient gene expression in neurons. This technology can produce a dispersed transfection pattern, similar to a Golgi stain, in which only individual cells receive the foreign DNA in a background of untransfected cells. Another advantage to using biolistic technology is that a gene gun can deliver DNA through relatively thick tissue, such as a tissue slice in culture. Therefore, it is possible to transfect cells within a slice that would be difficult to target using other gene delivery methods. This technique has not yet been successful in transfecting mammalian neurons in vivo, although it has been used in vivo to transfect liver and skin cells. The main disadvantage of using this technology is that it may cause physical damage to cells. Optimization is required to limit the amount of tissue damage caused by the force of impact of the projectiles.


Discussion

During the last few decades, transgenic rodent models have become powerful tools for studying the distribution [15, 17, 19] and function [31,32,33,34] of CRH neurons in the brain. In order to probe the morphological characteristics of CRH neurons at single-cell resolution, we combined genetic labeling (using transgenic mouse lines) with the fMOST platform to generate high-resolution imaging datasets, with which we characterized the morphologies of distinct CRH neurons distributed in various brain regions throughout the whole mouse brain.

The robust native fluorescence of each of these reporter mouse lines enabled direct visualization of fine dendritic and axonal structures of labeled neurons, which has been demonstrated to be useful for mapping neuronal circuitry, as well as imaging and tracking specific cell populations [35,36,37]. We compared the distribution patterns of fluorescent-labeled CRH neurons in three reporter mouse lines. We found that adult CRH-IRES-CreAi6 mice showed the highest number of labeled neurons in several brain regions (Fig. 1J). Although the three mouse lines were designed in a similar manner, the results may have been due to the sensitivity to Cre and strength of fluorescent reporters. Ai6 reporter lines are more sensitive to low levels of Cre, leading to a more thorough identification of Cre-positive populations [35], and the expression of the enhanced fluorescent protein ZsGreen1 were more easily to be seen. Another possible explanation is that Cre-mediated recombination had occurred in more cells in Ai14 or Ai32 reporter lines, but it was undetected owing to low reporter expression. Notably, the fluorescent fusion protein, CHR2-EYFP, is membrane-bound and is therefore distributed along the plasma membrane of neuronal processes within CRH-IRES-CreAi32 mice [38, 39], which enables a clear visualization of the entire neuronal morphology. Therefore, we utilized CRH-IRES-CreAi32 mice for whole-brain imaging and reconstructions. Interestingly, a large number of EYFP-labeled cortical pyramidal neurons was also observed in adult mice (which has not been reported previously from the onset age of postnatal day 21) (Additional file 1, Figure S3).

Next, we focused our analyses of reconstructed neurons mainly in several stress-related regions, including the mPFC, hypothalamus, amygdala, BST, and hippocampus. For example, it has been reported that local CRH-synthesizing neurons are prominent in the PFC [8, 40,41,42,43] and may modulate the activities of pyramidal neurons [7]. However, until now, the complete morphologies of CRH neurons in the mPFC have rarely been reported. Here, we reconstructed fluorescent-labeled CRH neurons in the cortical column in the PrL within mPFC across layers 1–4 (Fig. 4A). Importantly, we classified different neuronal types by their soma depths and arborization patterns (example listed in Fig. 4B). For the first time, we showed the distribution of CRH neurons with different morphological types in different cortical layers. We found there were dense dendrites (Fig. 4A) with dendritic swellings (Additional file 1, Figure S3, b) in layer 1 (the soma of which were located in layer 2/3 or layer 4), and that fibers extended to the surface of the cortex. According to the layer-specific dendritic locations and their different projection targets, several types of putative connection patterns between CRH neurons were identified in the cortex (listed in Fig. 4F–H). Such a diverse dendritic connection pattern of cortical CRH neurons may reflect differential innervation of downstream output targets (each amplified subfigure shown in Fig. 4F–H). Therefore, by characterizing their somatic locations and unique respective local dendritic morphologies of CRH neurons, our present study not only increases our current understanding of the distribution of CRH neurons, but also enables future studies to further elaborate upon cell-specific classifications. Taken together, these findings may help elaborate future functional studies of morphologically diverse CRH neurons in the PFC.

Importantly, CRH functions as a neuropeptide hormone produced in neuroendocrine neurons in the PVN and regulates the synthesis and secretion of glucocorticoids from the adrenal glands through the action of adrenocorticotropic hormone. For the first time, we reconstructed the intact morphologies of CRH neurons and their neurite varicosities located within dendrites (Fig. 5E) in the PaAp (Fig. 5A, B) and Pe CRH neurons (Fig. 5C, D). In the PaAp, most dendrites with varicosities projected rostrally (Fig. 5B), while in the Pe, the ends of the dendrites extended to the third ventricle and the large varicosities were attached to ependymal cells (Fig. 5C–D, G). We further identified that these dendritic varicosities contained the large dense core vesicle-associated protein, ChgB, and molecular motors (e.g., kinesins) used for intracellular transport and trafficking. Interestingly, a number of varicosities at the end of a dendrite located closely to the out layer of ependymal cells to third ventricle which were ChgB immunopositive (Fig. 5G). In addition, there were no EYFP-labeled CRH fibers distributed in the ependymal cells or passed through the cells. These results suggested that fibers of CRH neurons in the Pe make direct contacts to ependymal cells and may release to the 3rd ventricle by ependymal cells. Therefore, we speculate that these endocrine CRH neurons are different from those that project to the median eminence and that CRH may be also released by dendrites to other areas of the hypothalamus or cerebrospinal fluid to participate in its regulatory functions. We further found a negative correlation between somatic volume and varicosities number in the PaAp (Fig. 5L). Thus, our reconstructed morphological characteristics of dendritic varicosities may facilitate future classifications (according to different fiber orientations and varicosities distribution patterns) of hypothalamic CRH neurons and advance our understanding of their potentially diverse functions.

The reconstructed CRH neurons in different brain regions showed diverse distribution patterns and morphologies (Fig. 3a–h). We found that some neurons shared a common bipolar shape across various brain regions (Fig. 3i), especially in the hypothalamus (75% in the PaAp, 100% in SCN) and cortex. It has been reported that parvocellular CRH neuroendocrine neurons typically have two relatively thick primary dendrites that extend from opposite sides of the soma in a bipolar arrangement and branch once [44, 45] furthermore, bipolar cells are commonly found in the cortex [12, 46, 47]. Thus, our present study in CRH-reporter mice is consistent with these previous studies and is the first to describe the specific neural structures of these CRH neurons, such as the different types of connections between CRH neurons in the mPFC, as well as the intact morphologies of dendritic varicosities in hypothalamic CRH neurons. Such simplified branching properties of these CRH neurons in the hypothalamus may be conducive to their endocrine functions. Among all the reconstructed CRH neurons across different brain regions, their somata had different sizes (Fig. 3j), with somata in the LSD, VMPO, and hippocampus being larger than those in the PaAp, Pe, and SCN. Also, we found differential dendritic branch complexities across these regions. For example, CRH neurons in the mPFC, LSD, and hippocampus all exhibited more complex dendritic morphologies compared to those in the PaAP, Pe, and SCN (Fig. 3k–l). Hupalo et al. demonstrated that chemogenetic activation of caudal but not rostral dmPFC CRH neurons potently impaired working memory, whereas inhibition of these neurons improved working memory [29]. In addition, CRH acts in the medial septum to impair spatial memory [48] and acts in the BNST to participate in stress-induced maladaptive behaviors [49]. However, the functions of CRH in the OB, SCN, and VMPO remain unclear. Therefore, our current study may provide a detailed morphological basis for future functional-based studies on CRH neurons in these different brain regions. Interestingly, the PaAP, Pe, and SCN are all contained within the hypothalamus, and CRH neurons in these regions had smaller somata and exhibited more prevalent bipolar branching patterns compared to those of other brain regions analyzed in our present study. In the PVN, CRH neurons have been identified as parvocellular cells [44, 50]. We found that the mean somatic volume of CRH neurons in the Pe was larger than that of CRH neurons in the PaAP (Fig. 5H). Hence, we speculate that these data may be indicative of two different types of CRH endocrine neurons within the hypothalamus. Collectively, our quantitative analysis of these reconstructions demonstrates a region-specific diversity of CRH neurons in terms of both somatic size and branching complexity.

Dendritic spines are conventionally believed to be largely absent from inhibitory neurons. Previous studies by other groups and our previous research have shown that CRH neurons are GABAergic neurons that are located in many different brain regions, such as in the cortex [30] and hippocampus furthermore, CRH neurons are usually aspiny, while some long-range projecting CRH neurons in the BST and CeA have been reported to have spines [38]. In our present study, the arborization-dependent pattern of dendritic spines of CRH neurons was detected where the most sophisticated types of spines in the extended amygdala (BST and CeA) and the simplest one in the hypothalamus (VMPO and SCN). Interestingly, while spiny GABAergic CRH neurons in the BST and CeA were confirmed, aspiny CRH neurons were also found in these areas.


DISCUSSION

The results presented here demonstrate the strength and versatility of multicolor genetic labeling in zebrafish and provide well-characterized tools and validated methods that can be readily adopted. The ubi:Zebrabow and UAS:Zebrabow lines are suitable for both broad and tissue-specific multicolor labeling: color is faithfully inherited between daughter cells and is stable over time, and clone-like structures can be identified in tissues ranging from the cornea and forebrain to caudal fin and cartilage. As different Zebrabow and Cre combinations have distinct advantages (Tables 2 and 3), investigators can select from a wide array of approaches to suit their imaging needs. Thus, Zebrabow provides the resources necessary for systematic anatomical and lineage studies during zebrafish development.

Optimizing color stability and diversity

Our results show that Zebrabow colors remain stable over time. However, colors only become stable after color establishment and maturation. First, Cre needs to be expressed and then recombine the Lox sites. Second, fluorescent protein concentration needs to reach a steady state. The non-default fluorophores (CFP and YFP) need time to accumulate, whereas the default fluorophore (RFP) needs time to degrade. Thus, the color maturation rate depends on the timing of Cre recombination, the amount of residual RFP, and accumulation of mature CFP and YFP. One way to minimize maturation time is to induce Cre-mediated recombination prior to the significant accumulation of RFP. To maintain color stability, it is also essential that Cre activity is transient so that RFP expression is not continuously changed to CFP or YFP expression.

Imaging conditions also impact color stability. Different fluorescent proteins have different photostability profiles, excitation and emission spectra, and abilities to withstand fixation (Shaner et al., 2008 Shaner et al., 2005 Weissman et al., 2011). These factors can impact color after sample preparation and imaging. For example, in deeper tissues, longer wavelength light (emitted by RFP) will be scattered less than shorter wavelength light. We have focused on more superficial structures because imaging beyond the depth of 200-300 μm remains challenging. It will be interesting to test whether recent advances in microscopy or tissue clearing techniques will improve Zebrabow imaging in deeper structures (Hama et al., 2011 Kaufmann et al., 2012 Keller et al., 2008 Kuwajima et al., 2013). Intense laser excitation may also skew the relative ratio of the three fluorophores because RFP and CFP are less photostable than YFP (Weissman et al., 2011). Our results show the ability of Zebrabow to generate stable colors, but color establishment and stability need to be tested empirically.

Color diversity is another important variable in multicolor imaging. High color diversity makes each cell more traceable and reduces the chance that different clones have identical colors. Our results show that Zebrabow color profiles change in a predictable trajectory in response to increasing Cre levels and activity. As long as Cre activity is tunable (with heat shock or tamoxifen), it is possible to generate optimal color diversity. We also found that the number of cells that have undergone recombination increases with increasing Cre activity. Recombination takes place in fewer cells under low color diversity conditions and in more cells under high diversity conditions. In applications in which both sparse labeling and high color diversity are required, transplantation approaches (e.g. ubi:Zebrabow into wild type) can be used to reduce labeling density (data not shown).

Clonal analyses

Our study demonstrates that Zebrabow has the potential for clonal analysis in a wide variety of tissues, including the cornea, brain, muscle, cartilage and vasculature. The diversity of clone-like clusters in different organs suggests different modes of progenitor expansion during organogenesis. For example, the presence of large cohesive clusters suggests not only rapid proliferation of a small pool of progenitor cells but also limited dispersal of daughter cells from their site of origin. Such aspects of cell behavior can be studied readily with the techniques used here.

Putative clones can be identified not only by the shared colors of cohesive clusters, but color may also be used to determine whether dispersed cells might be clonally related. Compared with single or double labeling, the wide diversity of color in Zebrabow reduces the likelihood that unrelated cells have the same color. However, extensive dispersal of cells with similar color can hinder the unambiguous assignment of clonal relationships. One approach to help identify clones would be to compare the number of cells per single-color clone (clone size) at different labeling density: if cells with the same color are clonally related, clone size will be the same regardless of labeling density. By contrast, if many unrelated cells share the same color, clone size would increase with labeling density. Such calculations have been performed in retroviral clonal analysis and could be applied to color analysis (Galileo et al., 1990).

In the cornea, it has long been believed that epithelial stem cells are located exclusively in the limbus and that corneal clones are formed by centripetal growth from the limbus (Davies and Di Girolamo, 2010 Lavker et al., 2004). Interestingly, new evidence suggest that corneal stem cells might be scattered over the entire cornea and that corneal clones may be formed by centrifugal, rather than centripetal, growth (Majo et al., 2008). We find that many zebrafish corneal clones are derived from the peripheral cornea, a region analogous to the limbus. Although our results do not exclude the possibility that a subset of clones might originate from the central cornea, time-lapse imaging of single clones suggests that corneal clones form by centripetal expansion of limbus-derived clones. These results demonstrate that the Zebrabow resource described here is ideally suited to address fundamental questions in organogenesis and tissue homeostasis.


Using CRISPR, new technique makes it easy to map genetic networks

Credit: CC0 Public Domain

CRISPR-Cas9 makes it easy to knock out or tweak a single gene to determine its effect on an organism or cell, or even another gene. But what if you could perform several thousand experiments at once, using CRISPR to tweak every gene in the genome individually and quickly see the impact of each?

A team of University of California, Berkeley, scientists has developed an easy way to do just that, allowing anyone to profile a cell, including human cells, and rapidly determine all the DNA sequences in the genome that regulate the expression of a specific gene.

While the technique will mostly benefit basic researchers who are interested in tracking the cascade of genetic activity—the genetic network—that impacts a gene they're interested in, it will also help researchers quickly find the regulatory sequences that control disease genes and possibly find new targets for drugs.

"A disease where you might want to use this approach is cancer, where we know certain genes that those cancer cells express, and need to express, in order to survive and grow," said Nicholas Ingolia, UC Berkeley associate professor of molecular and cell biology. "What this tool would let you do is ask the question: What are the upstream genes, what are the regulators that are controlling those genes that we know about?"

Those controllers may be easier to target therapeutically in order to shut down the cancer cells.

The new technique simplifies something that has been difficult to do until now: backtrack along genetic pathways in a cell to find these ultimate controllers.

"We have a lot of good ways of working forward," he said. "This is a nice way of working backward, figuring out what is upstream of something. I think it has a lot of potential uses in disease research."

"I sometimes use the analogy that when we walk into a dark room and flip a light switch, we can see what light gets switched on. That light is like a gene, and we can tell, when we flip the switch, what genes it turns on. We are already very good at that," he added. "What this lets us do is work backward. If we have a light we care about, we want to find out what are the switches that control it. This gives us a way to do that."

Ryan Muller, a graduate student in the Ingolia lab, and colleagues Lucas Ferguson and Zuriah Meacham, along with Ingolia, will publish the details of their technique online on Dec. 10 in the journal Science.

Since the advent of CRISPR-Cas9 gene-editing eight years ago, researchers who want to determine the function of a specific gene have been able to precisely target it with the Cas9 protein and knock it out. Guided by a piece of guide RNA complementary to the DNA in the gene, the Cas9 protein binds to the gene and cuts or, as with CRISPR interference (CRISPRi), inhibits it.

In the crudest type of assay, the cell or organism either lives or dies. However, it's possible to look for more subtle effects of the knockout, such as whether a specific gene is turned on or off, or how much it's turned up or down.

Today, that requires adding a reporter gene—often one that codes for a green fluorescent protein—attached to an identical copy of the promoter that initiates expression of the gene you're interested in. Since each gene's unique promoter determines when that gene is expressed, if the Cas9 knockout affects expression of your gene of interest, it will also affect expression of the reporter, making the culture glow green under fluorescent light.

Nevertheless, with 6,000 total genes in yeast—and 20,000 total genes in humans—it's a big undertaking to tweak each gene and discover the effect on a fluorescent reporter.

"CRISPR makes it easy to comprehensively survey all the genes in the genome and perturb them, but then the big question is, How do you read out the effects of each of those perturbations?" he said.

This new technique, which Ingolia calls CRISPR interference with barcoded expression reporter sequencing, or CiBER-seq, solves that problem, allowing these experiments to be done simultaneously by pooling tens of thousands of CRISPR experiments. The technique does away with the fluorescence and employs deep sequencing to directly measure the increased or decreased activity of genes in the pool. Deep sequencing uses high-throughput, long-read next generation sequencing technology to sequence and essentially count all the genes expressed in the pooled samples.

"In one pooled CiBER-seq experiment, in one day, we can find all the upstream regulators for several different target genes, whereas, if you were to use a fluorescence-based technique, each of those targets would take you multiple days of measurement time," Ingolia said.

CRISPRing each gene in an organism in parallel is straightforward, thanks to companies that sell ready-made, single guide RNAs to use with the Cas9 protein. Researchers can order sgRNAs for every gene in the genome, and for each gene, a dozen different sgRNAs—most genes are strings of thousands of nucleotides, while sgRNAs are about 20 nucleotides long.

The team's key innovation was to link each sgRNA with a unique, random nucleotide sequence—essentially, a barcode—connected to a promoter that will only transcribe the barcode if the gene of interest is also switched on. Each barcode reports on the effect of one sgRNA, individually targeting one gene out of a complex pool of thousands of sgRNAs. Deep sequencing tells you the relative abundances of every barcode in the sample—for yeast, some 60,000—allowing you to quickly assess which of the 6,000 genes in yeast has an effect on the promoter and, thus, expression of the gene of interest. For human cells, a researcher might insert more than 200,000 different guide RNAs, targeting each gene multiple times.

"This is really the heart of what we were able to do differently: the idea that you have a big library of different guide RNAs, each of which is going to perturb a different gene, but it has the same query promoter on it—the response you are studying. That query promoter transcribes the random barcode that we link to each guide," he said. "If there is a response you care about, you poke each different gene in the genome and see how the response changes."

If you get one barcode that is 10 times more abundant than any of the others, for example, that tells you that that query promoter is switched on 10 times more strongly in that cell. In practice, Ingolia attached about four different barcodes to each guide RNA, as a quadruple check on the results.

"By looking more directly at a gene expression response, we can pick up on a lot of subtlety to the physiology itself, what is going on inside the cell," he said.

In the newly reported experiments, the team queried five separate genes in yeast, including genes involved in metabolism, cell division and the cell's response to stress. While it may be possible to study up to 100 genes simultaneously when CRISPRing the entire genome, he suspects that, for convenience, researchers would limit themselves to four or five at once.


Genetic Engineering in Food: The Jury’s Still Out

Genetic engineering in food can be utilized for the production of improved fruits, vegetables, and food crops. But it needs to be handled with responsibility. Read this BiologyWise article to explore the world of genetic engineering of food.

Genetic engineering in food can be utilized for the production of improved fruits, vegetables, and food crops. But it needs to be handled with responsibility. Read this BiologyWise article to explore the world of genetic engineering of food.

Genetic engineering deals with the direct manipulation of genes of organisms. Techniques like molecular cloning and transformation are used to achieve this. With the help of these techniques, the genetic structures and characteristics of a life form can be altered.

Would you like to write for us? Well, we're looking for good writers who want to spread the word. Get in touch with us and we'll talk.

In molecular cloning, a DNA sequence is isolated and its multiple copies are obtained. This technique is often used in the amplification of DNA sequences. In the transformation technique, a change is brought about in the genetic structure of a cell by introducing a foreign DNA into it.

A segment of DNA is a protein sequence. By changing this sequence, different versions of that protein can be obtained. Until now, genetic engineering has been successfully applied for the improvement of crops and in the manufacture of medicines to a certain extent. It has been used in the alteration of genes in organisms to develop improved versions of the species.

How are genetic engineering techniques used to modify crops?

  • The most common method is of using a gene gun to introduce genes into plant cells. DNA bound to particles of gold or tungsten are shot into the plant tissue or cells, under high pressure. The particles penetrate the cell wall and membranes, DNA separates from the metal and integrates itself in the plant DNA inside the nucleus.
  • In the Agrobacterium tumefaciens-mediated technique, Agrobacteria introduce their genes into plant hosts.
  • In case of electroporation, DNA enters plant cells through small pores created by electric pulses.
  • In microinjection, genes are injected into the DNA.

Genetic engineering to introduce new traits in plants, can lead to increase in their yield, improve agricultural practices, and improve the nutritional value of food. Plants tolerant to weed killers, allow farmers to kill weeds without worrying about the crops. The advantages of herbicide or insecticide-resistant crops are similar. The future of genetically engineering crops could be the development of edible vaccines. Development of potatoes with edible vaccines for diarrhea, and cultivation of tobacco with antibodies for dental caries, is in the stage of pre-clinical human trials.

Out of the three important cereals namely wheat, rice, and corn, wheat was the last to be transformed genetically. Recombinant DNA techniques were used to create the first transgenic wheat around the 1980s.

Biotechnology is the term used for genetic engineering in food. As the name suggests, it is a technology based on biology. It deals with agriculture, medicine, and food science. Before 1971, this term was used in relation with the agriculture and food processing industries.

By the use of genetic engineering, genes can be transferred to a developed variety of crop to achieve a higher yield. The transfer of genes which impart the characteristic of greater yield, is critical. But it is also one of the most beneficial applications of genetic engineering in food. With the help of genetic engineering techniques, certain desirable traits are introduced in crops, which include pest resistance, improvement in the crop’s nutrient profile, or resistance to environmental conditions and chemical treatments.

An antibiotic-resistant tobacco plant cultivated in 1982 was the first genetically modified crop. Field trials to produce insect-resistant tobacco plants occurred for the first time in the USA and France. China was the first country to allow the use of transgenic plants.

Would you like to write for us? Well, we're looking for good writers who want to spread the word. Get in touch with us and we'll talk.

Biotechnology can be used to improve the nutritional value of foods. This is indeed an application of great potential. Along with the improvement in nutrition, a better taste can be imparted to foods by engineering them genetically. This requires the use of biotechnology to slow down the process of food spoilage. It can result in the production of fruits and vegetables that have a longer shelf life. Perishability of foods can be reduced to a great extent, thus giving a boost to the agriculture and food industry.

Tomatoes were the first food crop with an edible fruit where it was possible to insert genetic material in the cell’s chloroplast and chromoplast plastomes. They have been genetically engineered to study fruit ripening. Those with an antifreeze gene were developed to make them frost-tolerant. They were tested to improve their tolerance to cold and drought. They have been altered to develop resistance to bacterium Bacillus thuringiensis and to improve their nutrient profile and taste.

Recently, researchers have identified a plant gene called At-DBF2, which when transferred to tomato and tobacco cells, increases their endurance to harsh soil and climatic conditions. It is often seen that certain types of soils or climatic conditions in certain regions, are the reasons for less growth of the crops there. This limitation can be overcome by genes that impart a withstanding capacity to crops. Similarly, it is good if genetic engineering can reduce the dependability of crops on fertilizers. It can make the plants tolerant to herbicides and resistant to harmful insects and pests.

In 1999, the first virus-resistant papayas were commercially grown in Hawaii. The University of Hawaii started developing a papaya cultivar resistant to Papaya Ringspot virus. Viral genes encoding capsid proteins were transferred to the papaya genome. The proteins generate an immune response-like reaction, making the papaya immune or unsusceptible to the ringspot infection. Genetically modified papayas are approved for consumption in the USA and Canada, but not in the European Union.

Genetic engineering can be used to produce new substances such as proteins or other nutrients in food. Foods can be genetically modified to increase their medicinal value. Researchers see edible vaccines as a potential use of genetic engineering in food. This will give rise to homegrown vaccinations and easily available medicines. The costs incurred in their transportation and other costs involved will substantially reduce, leading to cost-effectiveness in medications. Corn has been engineered to produce pharmaceuticals.

Certain corn strains are genetically engineered to introduce desirable traits in them. Cultivars resistant to glyphosate herbicides were brought into commercial use in Monsanto in the year 1996. This corn variety was called the Roundup Ready Corn. Liberty Link corn variety, resistant to glufosinate was developed by Bayer CropScience.

Maize has been genetically modified to express proteins from the bacteria Bacillus thuringiensis, which is poisonous to certain insect pests. This corn variant is known as Bt corn. Lately, corn varieties resistant to ear worms and root worms have been developed. In 2013, drought tolerance was introduced into corn. These corn hybrids were known as DroughtGard and were produced in Monsanto.

This Isn’t True!

You may come across images like these, but the cross of apples with oranges is not a reality. Oranges cannot cross produce with apples as the two belong to different species. Their crossing would require gene splicing, which is difficult. Heard of the phrase ‘mixing apples and oranges’? Idiomatically, it means mixing two totally different things. And scientifically speaking too, apples and oranges cannot be genetically combined.

Criticism

The darker side of genetic engineering in food is that the processes involve the use of herbicides and contamination of genes in crops. Horizontal gene transfer and recombination can give rise to new pathogens. It may introduce virulency among pathogens. If certain resistance genes spread in the harmful bacteria themselves, we may waste our defenses to diseases. By genetically engineering food, we are in a way ignoring the possibility that transgenic life forms could be harmful.

Genetically engineered crops may supersede natural weeds. Genetic engineering in food may prove to be dangerous to other weeds and natural organisms. The self-replication of genetically modified life forms might render us helpless in controlling their production and growth.

If not done with great care, genetic engineering can have negative side effects on food. It can lead to undesirable mutations in genes. It may produce allergies in crops. Moreover, in case of genetically modified seeds, all of them are identical in their genetic structure. This might cause a widespread failure of a crop due to a pest attack. Some argue that in refining the appearance and taste of food, its nutritional value may be compromised.

This makes us realize that the seemingly rosy picture of genetic engineering in food may prove to be thorny too. Genetic engineering should be used with responsibility. High standards should be exercised to ensure safety in the genetically engineered foods. The bottom line is that before we introduce genetic alterations in food, we should have a clear understanding of their dangers. Failing to understand the negative aspects of genetic modification of foods, may pose a risk to our health and safety.

Related Posts

Learn some genetic engineering ethics when it comes to practices like cloning, that are in the eyes of many, immoral and a perverse attack on creation.

Genetic engineering process manipulates the DNA sequence to create a new one. The write-up focuses on the various benefits of genetic engineering.

Of late, there has been great debate over the process of human cloning. Whether it is ethical or unethical, genetic cloning is always seen as the greatest challenge in genetic&hellip


Can a cell receive multiple copies of an insert when using different MOIs? - Biology

The Science of Biotechnology

Discovering and Developing Medicines

How Are Biotech Medicines Made?


The Science of Biotechnology

Biotechnology has been used in a rudimentary form since ancient brewers began using yeast cultures to make beer. The breakthrough that laid the groundwork for modern biotechnology came when the structure of DNA was discovered in the early 1950s. To understand how this insight eventually led to biotech therapies, it&rsquos helpful to have a basic understanding of DNA&rsquos central role in health and disease.


Illustration is copyrighted material of BioTech Primer, Inc., and is reproduced herein with its permission.

What does DNA do?
DNA is a very long and coiled molecule found in the nucleus, or command center, of a cell. It provides the full blueprint for the construction and operation of a life-form, be it a microbe, a bird, or a human. The information in DNA is stored as a code made up of four basic building blocks, called nucleotides. The order in which the nucleotides appear is akin to the order of the letters that spell words and form sentences and stories. In the case of DNA, the order of nucleotides forms different genes. Each gene contains the instructions for a specific protein.

With a few exceptions, every cell in an organism holds a complete copy of that organism&rsquos DNA. The genes in the DNA of a particular cell can be either active (turned on) or inactive (turned off) depending on the cell&rsquos function and needs. Once a gene is activated, the information it holds is used for making, or &ldquoexpressing,&rdquo the protein for which it codes. Many diseases result from genes that are improperly turned on or off.


Methods

DNA Constructs and Reagents

BAC Clones RP23-412o5 and RP23-395m11 were obtained from Children's Hospital Research Institute (CHORI). BACLink -GM and -SP linking vectors were generously provided by Claire Huxley [10]. pLD53-SCAEB recombination vector was generously provided by Shiaoching Gong [8] and the mini lamda vector was generously provided by Donald M. Court [19]. Homology Arms were amplified using Pfx DNA polymerase (Invitrogen) and amplified using an icycler (Biorad).

Cloning Homology Arms into BACLinking Vectors

Trap homology arm 3 was amplified using oligos SPA3 5'TRAP (ACACCTCGAGTTGTCACTTACCAGGCAAGCTGTGACA) containing an Xho1 site and SPA3 3'TRAP (TCTCGGATCCTTCTGTCGACGGCAGAGGCAGGCGGATTTTGAGTT) containing a BamH1 and internal Sal1 site. Homology arm 3 was digested with Xho1/BamH1 and cloned into the Sal1/Bamh1 site of BacLink-SP using conventional cloning practices. Dmp1 homology arm 2 was amplified using the oligos SPA2 5'DMP (TCTCGTCGACCATCTATTTATACAATTGCTCACTGAG) containing a Sal1 site and SPA2 3'DMP (TCTCGGATCCCTCTATTATAAACTGCTGTGTGTCTAAG) containing a BamH1 site and subsequently cloned into the Sal1/BamH1 site of BacLink SP-TRAP-A3 to create BACLink SP-TRAP/DMP A3/A2. Ibsp homology arm 1 was amplified using the oligos SPA1 5'IBSP (TCTCCTCGAGGTCCTTTCTACAATACTTAGAAACTTAAGT) containing an Xho1 site and SPA1 3'IBSP (TCTCACGCGTTCTATTGGTAACCTGCCATTTTCCCTTAGA) containing a Mlu1 site. Arm1 was then cloned into the Mlu1/Xho1 site of BACLink SP-TRAP/DMP A3/A2 to create BACLink SP-TRAP/DMP/IBSP. This vector was then used to capture a genomic DNA fragment containing the genes DMP1 and IBSP described below. TRAP homology arm 4 was amplified using the oligos GMA4 5'TRAP (TCTCGTCGACTGGCACGTGGGATAAGTCTATGCATGT) containing a Sal1 site and GMA4 3'TRAP (CTCTGGATCCCAGTAGCTACCACTTGCTGGTTTTGAG) containing a BamH1 site and cloned into the Sal1/BamH1 site of BACLink-GM to create BACLink-GM TRAP-A4. TRAP homology arm 3 was amplified using oligos GMA3 5'TRAP (ACACCTCGAGTTGTCACTTACCAGGCAAGCTGTGACA) containing an Xho1 site and GMA3 3'TRAP (TCTCACGCGTGGCAGAGGCAGGCGGATTTTGAGTTCA) containing an Mlu1 site and cloned into the Xho1/Mlu1 site of BACLink-GM TRAP-A4 to create BACLink-GM TRAP-A3/A4. This vector was subsequently used to capture a genomic DNA region of the TRAP gene.

Subcloning Genes into BAC Linking vectors

RP23-412o5 and RP23-395m11 containing DH10B were made electrocompetent and transformed with mini lamda [19]. Colonies were selected for on Chloramphenicol (12.5 ug/ml) and Tetracycline (10 ug/ml) LB Agar plates and grown at 32c. Resistant colonies were expanded and made electrocompetent. To prepare electrocompetent cells containing mini lamda, cells were maintained at 32c, but at the end of the growth phase were heat shocked at 42c for 15 minutes to activate the Red Recombinase System. BACLink SP TRAP/DMP/IBSP was double digested with Not1/SacI and transformed into RP23-395m11/mini lamda bacteria and selected for on spectinomycin (50 ug/ml) resistant LB Agar plates. BACLink GM TRAP A3/A4 was digested with Xho I and transformed into RP23-412o5/mini lamda bacteria and selected for on gentamicin (5 ug/ml) resistant plates. Recombinants were initially screened by colony PCR where oligos were designed flanking homology arms, one being present in the vector and the other being present on the other side of the homology arm. For the DMP1/IBSP genomic DNA fragment oligos SP2 (GCCCTACACAAATTGGGAGA) and DMPR (ACTCTTTCCTTAAAGATATCAATTTAC) were used to screen the DMP1 end and Belo2658 (TTTGTCACAGGGTTAAGGGC) and IBSPR (TCTGCTGATGTGTCCACCAGCACTAAG) were used to screen the IBSP end. For the TRAP genomic DNA fragment oligos Belo 2658 and TRAP-A3R (AATTACAGATTTGTGAGATAGTCACAC) were used to screen the arm 3 end and GM5'end (CGTAACATCGTTGCTGCTGCGTAACAT) and TRAP-A4R (CCGCAGATGGACTTCTGTCCAGCTGAG) were used to screen the arm 4 end. Potential BAC subclones positively identified by PCR were further verified by restriction digested followed by FIGE.

Cloning of Homology Arms into pLD53 Vectors

Homology Arms were cloned into pLD53 Vectors using standard cloning practices. Homology arms were PCR amplified using PFX polymerase from RP23-412o5 and RP23-395m11 BAC clones. Two homology arms were amplified for each gene (referred to as arms A, B, C, D, E, & F). Primer sequences are as follows: TRAPBox E5'Mlu (TCTCACGCGTGAAGTCCAGTGCTCACATGAC), TRAPBoxE3' Not (AGTGGCGGCCGCCCATGAATCCATCTGTGAGGAAGAGAG), TRAPBoxF5'PAC1 (GTGCTTAATTAAGCGCTGACTTCATCATGTCTC), TRAPBoxF3'PAC1 (GTGCTTAATTAAGACATACACACAGACACACAC), IBSPBoxA5'Mlu (TCTCACGCGTCTGTGAAGTATTCAAGGTACTC), IBSPBoxA3'NHE (CTAGCTAGCTGCAATTTCTTCTG CAATTGAAG), IBSPBoxB5'BSIW1(GATCGTACGGACTGCTTTAATTTTGCTCAGC), IBSPBoxB3'PAC1 (GTGCTTAATTAATATCACTGGCTCTACTGTCAGTC), DMP1BoxCMlu (TCTCACGCGTGCTTCTGAG TTGGTGGAGAGATAC), DMP1BoxC3'NHE1(CTAGCTAGCGGATGCGATTCCTCTACCTGTAATGAAAG), DMP1 BoxD5'BSIW1/Cla1 (CATCGTACGATCGATGACTGTCATTCTCCTTGTGTTCC) DMP1BoxD 3'BSIW1(GATCGTACGGGATCGTAGTTCATACTACTTAC) Amplified products were run through a PCR clean up column (Qiagen), restriction digested and gel purified (Zymogen). Plasmids were digested and then briefly treated with Calf Intestinal Alkaline Phosphatase (New England Biolabs) followed by phenol chloroform extraction and precipitation. Vector and inserted were mixed, ligated at room temperature for 1 hour and electroporated into PIR2 cells. Transformants were selected on LB plates with ampicillin (50 ug/ml).

Inserting Fluorescent Proteins into Genes

After cloning in homology arms A and B, 1 ug of pLD53 was electroporated into 40 ul of electrocompetent bacteria containing the BAC clone of interest. Bacteria were grown for 1 hour in SOC media by shaking at 37c without antibiotic selection. The entire transformation suspension was plated onto LB plates with the appropriate antibiotics (ampicillin 50 ug/ml, gentamicin 5 ug/ml, spectinomycin 50 ug/ml). Ten colonies were picked and re-streaked onto a new plate and grown overnight. The next morning the ten colonies were grown in 1 ml LB media containing the appropriate antibiotic. When bacteria growth appeared, 50–100 ul of LB was taken to screen for an arm A recombination event by colony PCR. PCR primers were designed to flank the A homology arm. Gene specific sense primers were: TRAPrecomA (ACACATTACCATCAGACCCTG), IBSPrecomA (GTCTGATACCTCCGAAGAGCTCAC), DMP1recomA (GTTAGGTTGCTGTGTAATACTGGC). Fluorescent protein antisense primers were: CT genotype (GTTTACGTCGCCGTCCAGCTCGACCAGGAT) for ECFP and Topaz fluorescent proteins and mCherry genotype (GCACCTTGAAGCGCATGAACTCCTTGATGA) for mCherry fluorescent protein. The rest of the bacteria culture was grown to confluence and minipreps were carried out. BAC clones were digested with Sal I to verify integration of pLD53 vector (pLD53 introduces a SalI site). Two positive integrants as determined by colony pcr and FIGE were further processed for backbone resolution. Two colonies from each clone were picked from the original re-streaked plate and grown for one hour with shaking in LB media without ampicillin, but in the presence of gentamicin or spectinomycin. 10–100 ul of media was spread onto TG plates and grown overnight at 37c. 40 colonies were picked and replated onto LB plates containing the appropriate antibiotic (no amplicillin). To enrich for resolved clones gentamicin/ampicillin or spectinomycin/ampicillin plates were also used as a replica of the 40 clones. Small colonies were favored over larger colonies when picking clones. Twenty ampicillin sensitive colonies were grown initially screened by colony PCR to verify the presence of the fluorescent protein reporter. Diagnostic restriction digests and FIGE was further carried to verify the genomic integrity of the clones and confirm pLD53 backbone resolution. Moreover, primers flanking the B homology arm were also used in combination with recomBoxA oligos to confirm resolution: TRAPrecomB (CATAATCTGTCCTCTGGCCTG), IBSPrecomB (GAACAGCTGGCTGACAGCACTGAATCAAC), DMP1recomB (TCCAGTTACACCACATAG GAATTG).

Linking Genes of Interest

The bacteriophage Red recombinase system was introduced into BACLink-SP containing DMP1-mCherry and IBSP-Topaz reporter genes by transformation of mini lamda and bacteria cells were made electrocompetent as described above. 10 ug of BACLink-GM TRAP-ECFP was digested with I-PPO1, phenol/cholorform extracted, precipitated, and resuspended in TE. 2 ug of digested BAC was transformed into competent bacteria containing SP-DMP1mCherry/IBSP-Topaz. Transformed colonies were selected for on LB gentamicin plates (5 ug/ml). Clones were initially screen by PCR using primers BL-TRAP (ACAGATTTGTGAGATAGTCACACAATTC) and BL-DMP1 (GACAATGTTTGCAGACTATGAATGAAG) that flank the linked genomic region. PCR positive clones were further verified by diagnostic restriction digest.

Generation of Transgenic Animals

The linked BAC construct was purified from 250 mls of bacteria culture using a large construct kit (Qiagen). 10 ug of BAC was linearized with I-PPO1 restriction enzyme for 2 hours and was further purified on a CL-4B sepharose (Sigma) column that was pre-equilibrated with injection buffer (10 mM Tris pH7.5, 0.1 mM EDTA, 100 mM NaCl). Twelve 200 ul fractions were collected and BAC DNA was quantified using a pico green DNA assay (Molecular Probes) and/or using a Nanodrop spectrophotometer (Thermoscientific). Pronuclear injection was carried out at the UCONN Health Center Gene Targeting and Transgenic Facility (GTTF).

Preliminary Transgenic Characterization

For imaging of transgene expression in spine, 6 week old females were sacrificed in accordance with our animal care protocols and tissues were dissected and fixed in 4% paraformaldehyde for 4 days, decalcified in 28% sodium free EDTA for 5 days, immersed in 30% sucrose/1 mM MgCl2 for 1 day. Decalcified tissue was frozen embedded and cryosectioned on to cryofilm type IIC tape (Finetec). Sections were imaged on a Zeiss Z.1 Observer inverted microscope. Filter sets used for imaging were purchased from Chroma Technology and are as follows: (HQ500/20 Ex, HQ 535/30 Em, Q515lp beam splitter) for Topaz (YFP), (D436/20 Ex, D480/40 Em, Q455dclp beam splitter) for ECFP, (HQ577/20 Ex, HQ640/40 Em, Q595lp beam splitter) for mCherry. TRAP staining was carried out after imaging bone sections with for ECFP using the Acid Phosphatase Kit (Sigma).

Estimating Transgene Copy Number

Tails were clipped from three animals of each mouse line and wild type animals. Genomic DNA was prepared using a DNAeasy Blood and Tissue Kit (Qiagen) and real time PCR was carried out on an I-Cycler (Biorad) for the Trap gene 5'TRAP (GTCTGTGGAACTGACGGCTGTAGATGGCTA) 3'TRAP (AGTGGCGGCCGCCCATGAATCCATCTGTGAGGAAGAGAG) and normalized to the Biglycan gene 5'-Biglycan (CAGAGCTTACACCCACTAACATACTC) 3'-Biglycan (CTCCGAAGCCCATAGGACAGAAGTCA).

Fold difference of transgenic mouse lines was compared to wild type CD1 mice and transgene copy number was estimated based on this fold difference.


Watch the video: BUŇKA! BUŇKA! BUŇKA! CZ trailer (August 2022).