Information

Neisseria meningitidis transformation into a pathogen

Neisseria meningitidis transformation into a pathogen


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

I read the wikipedia article about Neisseria meningitidis, and it says that

N. meningitidis is a part of the normal nonpathogenic flora in the nasopharynx of up to 5-15% of adults

In some cases however, it infects the bloodstream, creating a Meningococcemia disease which is highly lethal. It may also create a meningococcal meningitis.

The article also says that this disease is somewhat infectious. Not as infectious as common cold, but it is known to cause epidemics in Africa and Asia.

My question is: How can it be so abundant in its non-pathogenic form (up to 15% of adults) yet cause epidemics? It seems that it's transmitted from nose to nose somehow and doesn't cause a disease, yet when it does cause a disease it also causes a disease upon transmission.

It's not like a strain of E. coli that may cause disease in immunosuppressed individuals yet is a part of normal microbiota for other people. Because then it wouldn't cause epidemics, since the majority of the population is immune to it as evidenced by the fact that it's part of their microbiota.

Does N. meningitidis mutate to become pathogenic? Do the nasal strain and the pathogenic strain have different genotypes?

I tried searching for an answer but didn't find any.

Thank you very much.


It's not like a strain of E. coli that may cause disease in immunosuppressed individuals yet is a part of normal microbiota for other people.

Well, actually, it is kind of like that.

The answer is complicated, but can be boiled down to, virulent serotypes of Neisseria meningitidis infect susceptible populations. For the short answer, just read between the highlighted boxes.

Invasive meningococcal disease results from the interplay of: (1) microbial factors influencing the virulence of the organism, (2) environmental conditions facilitating exposure and acquisition, and (3) host susceptibility factors favoring bacterial acquisition, colonization, invasion, and survival.

Virulent serotypes have capsules that help them evade detection and destruction; they have an outer envelope that helps them invade and infect susceptable individuals.

The virulence (14) of N. meningitidis is influenced by multiple factors: capsule polysaccharide expression, expression of surface adhesive proteins (outer membrane proteins including pili, porins PorA and B, adhesion molecules Opa and Opc), iron sequestration mechanisms, and endotoxin (lipooligosaccharide, LOS). N. meningitidis also has evolved genetic mechanisms resulting in a horizontal genetic exchange, high frequency phase, antigenic variation, and molecular mimicry, allowing the organism to successfully adapt at mucosal surfaces and invade the host.

The most susceptible populations are infants/babies (most frequently), young children and unvaccinated young adults (during outbreaks). These are the populations most likely to have no to low antibodies against the bacteria.

The meningococcus remains a common cause of bacterial meningitis in children and young adults in the USA (132), now mostly affecting children less than 2 years of age (102, 133). Two-thirds of meningococcal disease in the first year of life in the US occurs in infants less than 6 months of age (134). Worldwide, the rates of meningococcal disease are also highest for young children due to waning protective maternal antibody, but in epidemic outbreaks, older children and adolescents can have high rates of disease. Fifty percent of cases in infants in the US are due to serogroup B; serogroup C is mostly seen in adolescents and serogroups B and Y in older adults. Even though peak incidence occurs among infants and adolescents; one-third to one-half of sporadic cases are seen in adults older than 18 years.

Carrier state isn't lifelong or even year long, in fact, it can last as little as a few weeks.

When approximately 10% of individuals from the general population at any time were carrying N. meningitidis in the nasopharynx (Cartwright et al., 1987), the carriage rate was shown to be <3% in children younger than 4 years and increased to 24-37% in the age-group 15-24 years… Then carriage rates decrease to less than 10% in older age-groups.

and

Meningococcal carriage increases rapidly among university students in the first month of the academic year and much of this increase probably occurred during the first week (Neal et al., 2000). The study, performed at the University of Nottingham, UK, showed the carriage rate increased in the first week of term from 6.9 % on day 1, to 11.2 % on day 2, to 19.0 % on day 3 and to 23.1 % on day 4. High social mixing probably caused this increase.

Carrier state is influenced by protective antibodies, local mucosal factors, and lower virulence of the bacteria in carriers. Smokers, for example, are more likely to be carriers than non-smokers. The type of N. meningitidis also influences carrier vs. infected individuals.

In Norway, approximately 9% of the carriage isolates belonged to two of the known hypervirulent clonal complexes…

That is, of 100 carriers, less than 10% carry a very virulent type. Non-virulence or low-virulence is the norm.

A non-virulent strain can become virulent to others by sharing of DNA.

Because of mixed colonization with other bacteria and because of its duration, the carrier state is an ideal condition for horizontal gene transfer between different strains of meningococci, and between meningococci and other commensal bacterial species. The human nasopharynx may harbour diverse pathogenic bacteria, like N. meningitidis, H. influenzae, S. pneumoniae, as well as non-pathogenic bacteria, such as N. lactamica and the moraxellae.

Again, carriers ave protective antibodies.

Immunity to invasive meningococcal disease is dependent upon the presence of serum immunoglobulin G (IgG) which elicits bactericidal activity toward the infecting organism. Infants may be protected from meningococcal disease by the presence of maternal IgG which is obtained passively during gestation and lactation. Maternal immunity will be replaced by acquired immunity. Exposure to non-pathogenic Neisseria and other cross-reacting species in the nasopharynx increases the level of specific antibodies during childhood (Sanchez et al., 2001, 2002; Troncoso et al., 2000).

And

Carriage of commensal Neisseria, especially N. lactamica, is associated with a high titre of antibodies against N. meningitidis. Highly homologous structures are present in N. lactamica and N. meningitidis (Troncoso et al., 2000, 2001). Sera from mice immunized with N. lactamica and boosted with N. meningitidis have been shown to kill meningococci.

… Mucosal immunity is not able to prevent the colonization of the nasopharynx by meningococci, but it plays an important role in preventing the invasion of epithelial cell (Griffiss, 1995).

If that answers your question, that's what I hoped for, because the rest is a mystery to me. But remember, you aren't a lifelong carrier. You might be a weekslong carrier, and every exposure to a non-virulent serotype increases your immunity.

Neisseria meningitidis: Biology, Microbiology, and Epidemiology
Neisseria meningitidis: an overview of the carriage state


Chapter 7: Identification and Characterization of Neisseria meningitidis

N. meningitidis are gram-negative, coffee-bean shaped diplococci that may occur intracellularly or extracellularly in PMN leukocytes. N. meningitidis is a fastidious organism, which grows best at 35-37°C with

5% CO2 (or in a candle-jar). It can grow on both a blood agar plate (BAP) and a chocolate agar plate (CAP). Colonies of N. meningitidis are grey and unpigmented on a BAP and appear round, smooth, moist, glistening, and convex, with a clearly defined edge. N. meningitidis appear as large, colorless-to-grey, opaque colonies on a CAP. Prior to identification and characterization testing procedures, isolates should always be inspected for purity of growth and a single colony should be re-streaked, when necessary, to obtain a pure culture. For the following identification and characterization procedures, testing should be performed on 18-24 hour growth from a BAP (Figure 1) or a CAP (Figure 2) at 35-37°C with

The following tests are recommended to confirm the identity of cultures that morphologically appear to be N. meningitidis (Figure 3). N. meningitidis can be identified using Kovac&rsquos oxidase test and carbohydrate utilization. If the oxidase test is positive, carbohydrate utilization testing should be performed. If the carbohydrate utilization test indicates that the isolate may be N. meningitidis, serological tests to identify the serogroup should be performed. This sequence of testing is an efficient way to save costly antisera and time. Additional methods for identification and characterization of N. meningitidis using molecular tools are described in Chapter 10: PCR Methods and Chapter 12: Molecular Methods.

Biosafety Level 2 (BSL-2) practices are required for work involving isolates of N. meningitidis, as this organism presents a potential hazard to laboratory personnel and the surrounding working environment. Please refer to Chapter 4: Biosafety in order to follow the guidelines that have been established for laboratorians working in BSL-2 facilities as many of the tests described in this chapter require opening plates with live cultures and are often performed outside of a biosafety cabinet (BSC). molecular tools are described in Chapter 10: PCR Methods and Chapter 12: Molecular Methods.

Figure 1. N. meningitidis colonies on a BAP

Figure 2. N. meningitidis colonies on a CAP

Figure 3. Flow chart for identification and characterization of a N. meningitidis isolate

  1. Kovac&rsquos oxidase test Kovac&rsquos oxidase test determines the presence of cytochrome oxidase. Kovac&rsquos oxidase reagent, tetramethyl-p-phenylenediamine dihydrochloride, is turned into a purple compound by organisms containing cytochrome c as part of their respiratory chain. This test aids in the recognition of N. meningitidis, but other members of the genus Neisseria, as well as unrelated bacterial species, may also give a positive reaction. Positive and negative quality control (QC) strains should be tested along with the unknown isolates to ensure that the oxidase reagent is working properly.
    1. Preparation of 1% oxidase reagent from oxidase powder To prevent deterioration of stock oxidase powder, the powder should be stored in a tightly sealed desiccator and kept in a cool, dark area. Kovac&rsquos oxidase reagent is intended only for in vitro diagnostic use. Avoid contact with the eyes and skin as it can cause irritation. In case of accidental contact, immediately flush eyes or skin with water for at least 15 minutes.
      1. Prepare a 1.0% Kovac&rsquos oxidase reagent by dissolving 0.1 g of tetramethyl-p-phenylenediamine dihydrochloride into 10 ml of sterile distilled water.
      2. Mix well and then let stand for 15 minutes.
        • The solution should be made fresh daily and the unused portion should be discarded.
        • Alternatively, the reagent could be dispensed into 1 ml aliquots and stored frozen at -20°C. The aliquots should be removed from the freezer and thawed before use. Discard the unused portion each day the reagent is thawed.
      Filter paper method

      Figure 4. Kovac's oxidase test: a negative and positive reaction on filter paper Plate method

      Plate method
      • Do not flood the entire plate as the bacteria exposed to the reagent are usually not viable for subculture.
      • Positive reactions will develop within 10 seconds in the form of a purple color where the bacteria were applied to the treated filter paper. Delayed reactions are unlikely with N. meningitidis.
      • Negative reactions will not produce a color change on the treated filter paper.

      Figure 5. CTA sugar reactions for N. meningitidis with utilization of glucose (dextrose) and maltose, indicated by acid production (color change to yellow), and no utilization of lactose or sucrose

      Table 1. Carbohydrate utilization by some Neisseria and Moraxella spp.

      Acid Production from:
      Table 1. Carbohydrate utilization by some Neisseria and Moraxella spp.
      Organism Glucose 1 Maltose Lactose Sucrose
      Neisseria meningitidis + + &ndash &ndash
      Neisseria lactamica + + + &ndash
      Neisseria gonorrhoeae + 2 &ndash &ndash &ndash
      Neisseria sicca + + &ndash +
      Moraxella catarrhalis &ndash &ndash &ndash &ndash

      Footnotes

      • 1 Glucose may also be referred to as dextrose.
      • 2 Some strains of N. gonorrhoeae are weak acid producers and may appear to be glucosenegative in the CTA medium.
      • Each isolate will require as many sections on the slide as the individual serogroup-specific antisera that will be tested as well as a saline negative control.
      • The instructions specify using a micropipettor with sterilized filtered tips to measure the 10 µl of the 5% formalinized saline to suspend the bacteria. The micropipettor will transfer precise and equal measurements for a proper SASG reaction.
      • If a micropipettor and tips are not available, sterile, disposable 10 µl inoculation loops can be used to transfer 10 µl of the 5% formalinized saline, but often do not deliver accurate amounts (between 5-10 µl).
      • If the bacteria are difficult to suspend directly on the slide, make a moderately milky suspension (comparable to McFarland 6 standard) of the test culture in a small vial with 250 µl of 5% formalinized saline and briefly vortex the suspension to mix and break up any pellets. Add 10 µl of this suspension to the lower portion of the slide.
      • DO NOT use the dropper provided with the antisera because it usually delivers larger amounts than is necessary and can easily be contaminated.
      • If a micropipettor and tips are not available, sterile, disposable 10 µl inoculation loops can be used to transfer 10 µl of the antisera, but often do not deliver accurate amounts (between 5-10 µl).
      • Dispose of the tip or loop used to transfer the antisera to the slide in a waste container after each use to avoid contamination of the antisera. If the source of antisera is contaminated, a new vial must be used.

      Figure 6. Rating the intensity of the agglutination reaction

      • A positive result is designated by a 3+ or 4+ (strong agglutination) within 1-2 minutes, except for serogroup B, which is considered positive with a rating of 2+ or greater.
      • A negative result is designated by a 0 (saline), +/-, 1+ or 2+ (weak agglutination).
      • The serogroup is determined when a positive result occurs with only one of the antisera and not with the saline.
      • If a serogroup is not determined, the isolate is considered NG. The following result combinations are all reported as NG:
        • Agglutination in the saline, regardless of strong reactions with other antisera, characterizes the culture as autoagglutinating.
        • Agglutination with more than one serogroup-specific antisera in the absence of agglutination in saline characterizes the culture as polyagglutinating or cross-reactive.
        • No agglutination with any of the antisera or the saline characterizes the strain as non-reactive.
        1. Repeat the test directly on the slide using growth from another section of the same plate.
        2. Make a cell suspension in a small tube and vortex if the result from SASG directly on the slide is unclear and repeat the test.
        3. Add 20 µl of antisera directly to slide and then add a loop full of organism without diluting the specimen with 5% formalinized saline.
        4. Subculture and retest fresh growth the following day.
        5. If the original plate contains different size colonies, make a subculture for each type of colony and test both cultures the next day. The larger colonies usually indicate better capsule production and therefore better reactivity. However, the smaller colonies will occasionally give a better result.
          • If discrepancies are not immediately resolved, any subsequent SASG repeats should be used in conjunction with control strains.
        • Performed for each new lot of antisera received in the laboratory.
        • Performed biannually after initial QC testing.
        • Repeated if a vial has been exposed to temperatures above 4°C or if there is reason to suspect that the vial has been contaminated since the initial QC was performed.

        Follow the SASG testing procedure to QC each lot of antisera using all reference strains available in the laboratory. Record the results provided on the example QC sheet in Figure 7.

        Reading the QC test results
        • The antiserum must give 3+ or 4+ agglutination with homologous antigens within 1-2 minutes.
        • The antiserum must not react with heterologous N. meningitidis serogroups, with the NG reference strain, or in saline.
        • The antiserum agglutinates with one or more reference strains and/or with the NG reference strain and/or in saline.

        Figure 7. Example QC sheet for testing antisera against all N. meningitidis serogroups


        EPIDEMIOLOGY

        Globally, the great majority of meningococcal disease in immunocompetent individuals is caused by strains of three serogroups - A, B and C. Serogroup A disease dominates in the "meningitis belt" of sub-Saharan Africa, in the Middle East, Asia and in some other tropical countries. In higher-latitude countries including the North American continent, Europe and Australasia, serogroups B and C predominate. In the United States, strains of serogroup Y cause approximately one third of cases, with unusual predilections for older adults and for causing lower respiratory tract infection.

        Attack rates vary widely by region, by country and over time. Overall disease rates in higher-latitude countries are often about 1-2 per 10 5 population, but higher rates are not uncommon from time to time. In the U.S.A., attack rates have been less than 1 per 10 5 population for some years (3, 14). Meningococci can cause clusters of cases in families, schools universities and military training establishments. They can also cause more diffuse, community-wide outbreaks which are usually due to strains of a single clonal type. For some years in the 1990s there were outbreaks of serogroup W disease amongst Muslims visiting Saudi Arabia while undertaking Haj or Umrah pilgrimage. The outbreaks were controlled by the introduction of compulsory vaccination for visiting pilgrims.

        Overall, attack rates are highest in the very young, peaking at about age 7 months then falling steadily to age 10 years, followed by a second and smaller peak in those in their late teens (33). The disease incidence in adults is low. The sex ratio of cases usually shows a small male preponderance.

        Infants, among whom the prevalence of protective antibodies is low, only rarely acquire meningococci when they do, the chances of invasive disease are high. The second disease peak in teenagers and young adults may be associated with to the peak of carriage, and more importantly, the peak of acquisition that occurs around this age.

        Massive pancontinental epidemics due to serogroup A strains occur in sub-Saharan Africa (the so-called "meningitis belt") at intervals of about 5-10 years with attack rates of 100 or more per 10 5 population. These are due to the introduction and dissemination of new meningococcal clones within susceptible populations (2).


        Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation

        Background: This study aimed the use of mesoporous silica under the naturally transformable Neisseria meningitidis, an important pathogen implicated in the genetic horizontal transfer of DNA causing a escape of the principal vaccination measures worldwide by the capsular switching process. This study verified the effects of mesoporous silica under N. meningitidis transformation specifically under the capsular replacement.

        Methods: we used three different mesoporous silica particles to verify their action in N. meningitis transformation frequency.

        Results: we verified the increase in the capsular gene replacement of this bacterium with the three mesoporous silica nanoparticles.

        Conclusion: the mesouporous silica particles were capable of increasing the capsule replacement frequency in N. meningitidis.


        Work on N. meningitidis at Leicester

        Dr Chris Bayliss, from the Department of Genetics and Genome Biology, and his group are studying the genetics underpinning the success of N. meningitidis as a major human pathogen. The major areas of study are epidemiological studies of strain distributions and spread, bioinformatics of whole genome sequences, phenotypic analysis of strains and vaccinology. A key focus is on phase variation in this species.

        Epidemiology

        Dr. Bayliss' group has been involved in generating large collections of meningococcal isolates from university students who are asymptomatically colonised with N. meningitidis. Observations:- carriage of a single strain for 6 months occurs in 45% of carriers detection of a high prevalence of MenY strains in 2008-2011 carriage of MenW strains in vaccinated individuals and rapid amplification of a MenW ST-11 clone during the first few months of university life in 2015-2016.

        Bioinformatics

        Dr. Bayliss' group developed PhasomeIt to detect phase-variable genes in whole genome sequences. Using this tool, pathogenic Neisseria species (the meningococcus and gonococcus) and the commensal species N. lactamica were found to have many more phase-variable genes than other Neisserial species indicating that PV contributes to host colonisation and persistence. This group has also shown that a MenW ST-11 sub-clone evolved longer repeat tracts in multiple genes encoding surface proteins, a phenomenon that is likely to have increased the PV rate and facilitated strain transmission.

        Phenotypic analyses

        Key tools:- cell culture, whole blood culture and serum bactericidal assays. Key observations:- demonstration that the transferrin-binding protein is required for growth of meningococci in human blood repetitive tract in PorA, a major outer membrane protein, mediates escape from PorA-specific bactericidal antibodies by altering surface expression of this protein.

        Phase variation

        Epidemiological studies found an association between persistent carriage and PV-mediated reductions in expression of single-copy surface proteins, probably driven by host immune responses. These studies also showed that PV of the multiple-copy Opa proteins leads to switching between antigenically-divergent proteins during carriage whilst maintaining the adhesive properties of these proteins. Meningococcal disease isolates were also found to have both PilC proteins switched OFF whilst persistent carriage is correlated with a switch from PilC1 to PilC2.

        Vaccinology

        Bexsero®, a MenB vaccine, was introduced into the childhood immunisation schedule at the end of 2015. Funded by the Meningitis Research Foundation, Dr. Bayliss and his group have been assessing how to monitor the Bexsero® immunisation programme. By focussing on the sequences controlling expression of the factor H binding protein (one of the vaccine antigens), new approaches have been generated to help with understanding and monitoring performance of this vaccine in all cases of disease.


        Results

        Effect of deletion of dprA on Nm transformability

        A dprA null mutant of Nm strain MC58 was constructed. The requirement for a functional dprA locus for transformation has been demonstrated in Nm [10] as well as in Ng [17]. To test the role of DprANm in transformation with different DNA substrate conformations, wild-type and dprA null mutant cells were transformed with circular plasmid DNA, chromosomal DNA or PCR-amplified linear chromosomal DNA, all containing an identical pilG :: kan insert. In the wild-type background, transformation levels of 7.10휐 𢄥 , 1.43휐 𢄦 and 6.75휐 𢄦 were observed for genomic DNA, linear DNA and plasmid DNA substrate, respectively. In the dprA null background, the transformation rates were almost not detectable (detection limit: 1휐 𢄨 ) ( Fig. 1 ).

        DprA is absolutely required for DNA transformation in Neisseria meningitidis (Nm). Variation in quantitative transformation is shown for Nm MC58 wild-type and MC58 dprA :: aph with the DUS containing genomic DNA, linear DNA and plasmid DNA substrates. The values on the y-axis are on a log scale. The standard deviations from at least five independent experiments are indicated by bars.

        No effect of deletion of dprA on Nm DNA repair or recombination

        Wild-type and dprA null cells were exposed to the DNA-alkylating agents mitomycin C (MMC) and methyl methanesulfonate (MMS), and the oxidative agent paraquat dichloride (PQT) ( Fig. 2 ). Comparison of the survival rate between the wild-type and dprA null mutant cells after exposure to these DNA-damaging agents revealed no difference. However, a recombination-deficient control strain, M1080 recA6 (M400), showed significantly reduced survival (P𢙀.001, Student's t-test). This suggested that DprANm may have little or no role in the repair of alkylating or oxidative DNA damage.

        The Neisseria meningitidis (Nm) ΔdprA mutant did not show significant difference from the wild-type when exposed to DNA-damaging agents. The Nm MC58 wild-type and ΔdprA mutant were exposed to 0.1 mM paraquat, 0.5 m M MMS and 10 ng ml 𢄡 MMC. M1080 recA6 (i.e. IPTG-inducible recA, but with no IPTG added) was included as a recombination-deficient control, and showed significantly reduced survival. The standard deviations of the median from three independent experiments are indicated by bars.

        Cell-cycle progression was also assessed in Ng dprA null mutant strains and the wild-type strain by flow cytometry, which provided information on the DNA and protein content per cell, and the number of chromosome equivalents per cell. Both the wild-type and the ∆dprA mutant strains exhibited equal cell mass and contained equal numbers of chromosome equivalents, before and after rifampicin and cephalexin (CPX) treatments. However, the DNA content of the ΔdprA mutant cells was significantly affected after rifampicin and CPX exposure the DNA content of the ΔdprA mutant cells was 242, and that of the wild-type was 277 (fluorescence in arbitrary units, AU) (P=0.02, Student’s t-test). Although it was not significant, the untreated stationary phase ΔdprA mutant cells also contained smaller amounts of DNA (247 AU) than the wild-type cells (276 AU) (P=0.109, Student’s t-test) ( Table 1 and Figs S2 and S3).

        Table 1.

        StrainsDNA per cellMass per cellRelative DNA contentRelative mass
        MS11wt2761391.001.00
        MS11ΔdprA2471130.890.81
        MS11wt ++ 277941.001.00
        MS11ΔdprA ++ 242910.870.97

        ++ , Strains treated with rifampicin and cephalexin.

        Similarity of DprANm to well-characterized orthologues

        The deduced amino acid sequence of DprANm was aligned with sequences from DprASp and Helicobacter pylori DprA (DprAHp), revealing a high level of homology (38 and 30 % identity, respectively) at the protein level ( Fig. 3 ). Sequence conservation among the domains was also observed (Fig. S4), albeit with some degree of variation for example, the SAM of DprANm had 32 % identity with the DprARp SAM. The DprANm RF domain had 36, 45 and 47 % sequence identity with the RFs of DprAHp, DprARp and DprASp, respectively ( Fig. 3a𠄼 ). The dprA/DprA nucleotide and protein sequences from 6 Nm strains were aligned, revealing 67 SNPs, including 47 nsSNPs (Fig. S5a). Predictions of the effect on the function of the protein using SNAP2, however, identified that 46/47 (98 %) of the SAPs were conservative. Only the SAP at position 247 was predicted to have an effect on DprA function, with a score of 45 and an expected accuracy of 71 % (Fig. S5b). Based on published structural models for DprAHp and DprASp [21, 31], and associated biophysical data [20], we would expect the dimerization interface (termed 𠆌/C’) [21] to be conserved in DprANm ( Fig. 3d ). Quevillon-Cheruel et al. established the importance of this interface for the formation of the DNA substrate complex and transformation [21].

        Bioinformatics comparison of DprANm with orthologues – Streptococcus pneumoniae (DprASp), Helicobacter pylori (DprAHp) and Rhodopseudomonas palustris (DprARp). (a) Predicted overall domain structure of all four DprA orthologues. (b) Similarity plot for DprANm sequences with sliding window sizes (w) ranging from 4 to 20 aa. The average similarity for the whole sequence was set to 1. The borders of the three motifs are indicated with orange colour. (c) Deduced amino acid sequence alignment of the hallmark DprA domain, RF, from DprASp, DprAHp and DprANm. Experimentally suggested functional residues from DprASp and DprAHp are coloured. Two colours mean two functions. The arrows indicate experimentally proven functional residues from other species that are conserved in DprANm. The number below each arrow shows the residue number relative to the N-terminus of DprANm. (d) Predicted monomer–monomer interaction of the DprA from Nm strain MC58. Dimerization interface residues are shown in yellow. SAM, Sterile alpha motif Zα, a winged-helix DNA-binding motif/Z-DNA-binding domain.

        DprANm binds DNA

        EMSA was performed to analyse the affinity of recombinant DprA for single-stranded (ss) or double-stranded (ds) oligonucleotide DNA substrates. Homopolymer oligonucleotides (dT) of different lengths (dT12𠄽T100) were used and dT40 was sufficient for DprA to readily form a nucleoprotein complex, although the complex dissociates easily during electrophoresis ( Fig. 4a ). The affinity of DprANm for the DNA substrate increased with increasing length of the ssDNA oligo, and a very stable DNA𠄽prANm complex formed with dT80 ( Figs 4a and S6a). Unless indicated otherwise, the EMSA experiments described below were performed with a DNA substrate 80 nt or 80𠂛p in length (the physical properties and sequences are presented in Tables 2 and S3). DprANm binds ssDNA (C80) with significantly higher affinity (P=0.034, Student's t-test) ( Fig. 4b ) than it binds dsDNA (G80C80) ( Figs 4c and S6b).

        Electromobility shift assay analysis of Neisseria meningitidis (Nm) DprA DNA binding with DNA substrates of various lengths. Increasing binding affinity of DprA with increasing length of oligonucleotides when 30 nM of DprA was incubated with poly(T) (dT) oligonucleotide (dT12𠄽T100) was detected (a). DprA bound ssDNA (C80) with stronger affinity (b) compared to dsDNA (G80C80) (c), when an increasing concentration of DprA in (nM) was incubated with 1000 c.p.m. µl 𢄡 of [γ 32 P]ATP-labelled ssDNA (C80) and dsDNA (G80C80), respectively. Lane 1, No protein lane 2, 0.5 lane 3, 1.25 lane 4, 2.5 lane 5, 5 lane 6, 10 lane 7, 20 lane 8, 30 lane 9, 40 lane 10, 50 lane 11, 60 lane 12, 70 and lane 13, 80 nM protein.

        Table 2.

        Physical constantGTB25C80
        Oligonucleotide length8080
        Molecular weight (kDa)24.724.5
        G+C content (%)5849
        Melting temperature (ଌ)8076
        ΔG (Kcal mol 𢄡 )*131.1117.2

        The affinity of DprANm for C80 was compared to its affinity for an oligomer containing a DNA uptake sequence (DUS), GTB25. The results show that DprANm’s affinity for C80 and GTB25 is similar, although the mobility of the protein-bound DNA substrate during EMSA was slightly different, i.e. DprANm� migrated faster than DprANm–GTB25 ( Figs 5a and S7). Competitive binding assays were performed, in which pre-bound 32 P-end-labelled GTB25 or C80 was incubated with unlabelled competitor DNA, C80 or GTB25, respectively, or vice versa. The results confirm that DprANm binds to DUS containing GTB25 and to C80 with similar affinity [ Fig. 5b (i–iv)]. Interestingly, binding to labelled oligomer was stable in the presence of up to

        15 nM competitor DNA, which is equivalent to an approximately 160-fold molar excess of unlabelled competitor. The stability of the DrpANm-bound labelled oligomer decreased when the total DNA concentration exceeded 15 nM, at which point an extra band containing labelled oligomer (B2) appeared during EMSA, with mobility in between the band (B1) and free DNA (Figs S8–S11).

        DprA exhibits sequence-independent DNA binding. (a) Representative gel images showing increasing concentration of recombinant DprA protein (nM) incubated with 1000𠂜.p.m. µl 𢄡 of the [γ 32 P]ATP-labelled (hot) C80nt (i), GTB25 (ii), C80G80 (iii) and GTB25/26 (iv). Lane 1 – no protein. Lanes 2, 5, 8 and 11 – 20 nM. Lanes 3, 6, 9 and 12 – 30 nM. Lanes 4, 7, 10 and 13 – 40 nM. (b) Quantitation of the competitive electrophoretic mobility shift assay (for the gel images see Figs S11), where 30 nM recombinant DprA protein incubated with hot GTB25 competed with cold C80 (i), hot C80 competed with cold GTB25 (ii), hot GTB25 competed with cold GTB25 (iii), and hot C80 competed with cold C80 (iv). Note that GTB25 and GTB26 are DUS-containing oligonucleotides, whereas C80 and G80 are random-sequence oligonucleotides.

        DprANm binds SSBNm but not SSBNm𹒌 in vitro

        To determine whether DprANm interacts directly with SSBNm, we employed a size-exclusion chromatography column. When the mixture of DprANm and SSBNm was injected onto the column, a new peak appeared that eluted earlier (11.0 ml) than when each of the two proteins was injected alone ( Fig. 6a ). Injected alone, DprANm eluted at 13 ml and SSBNm eluted at 12.6 ml. This indicated that under the conditions used DprANm and SSBNm are capable of forming a complex in vitro, without the addition of DNA ( Fig. 6a ). When the same experiment was performed using SSBNm𹒌, no change was seen in the elution pattern of DprANm, indicating that no detectable complex formation occurred between DprANm and SSBNm𹒌 ( Fig. 6b ).

        DprANm interacts directly with SSBNm, but not with SSBNm𹒌. (a) Protein–protein interaction assay by size-exclusion chromatography with 40 µM DprANm and 80 µM SSBNm. Upper panel: chromatogram A280 (mAU) versus retention volume (ml). Lower panel: SDS-PAGE of 13 µl of each 0.5 ml fraction stained with Coomassie blue, 80 µM SSBNm mixed with 40 µM DprANm and each protein alone. The first fraction on each gel is 7 to 7.5 ml and the last fraction is 16 to 16.5 ml. (b) A similar experiment to that in (a), but with SSBNm𹒌 in place of SSBNm. (c) Microscale thermophoresis (MST) of DprANm with SSBNm and with SSBNm𹒌. The ligand concentration is plotted on the x-axis and the normalized fit values are plotted on the y-axis. For the DprANm–SSBNm interaction a Kd of 1458򱕄 nM was calculated.

        The multimeric state of DprANm and SSBNm was studied via size-exclusion chromatography with an inline SEC-MALS system under similar conditions to those during the co-size-exclusion chromatography assay. By measuring light scattering during elution of the main peaks, the software estimated a size for DprANm of 94� kDa and a size for SSBNm of 91� kDa. This is reasonably consistent with DprANm forming dimers with a theoretical size of 89.6 kDa and SSBNm forming tetramers with a theoretical size of 83.4 kDa. Dimerization of DprA has been reported for DprASp [21], and tetramerization of SSB has been reported for E. coli [68].

        In addition, using MST, the interaction between SSBNm and DprANm was further characterized. Titration of varying concentrations of DprANm against SSBNm gave data consistent with a single binding site and a calculated Kd value of 1458򱕄 nM ( Fig. 6c ). In contrast, the combination of recombinantly produced DprANm and SSBNm𹒌 did not result in detectable binding ( Fig. 6c ).

        DprA is co-transcribed with smg and topA

        Immediately downstream of dprANm are the genes smg and topA ( Fig. 6a ). The product of the smg gene is a novel RNA-binding protein that acts as a translation regulator in Drosophila melanogaster [69]. However, the function of smg is unknown in bacteria, while topA encodes DNA topoisomerase I, a type IA topoisomerase. In the Nm MC58 genome, dprA, smg and topA were predicted by STRING to constitute an operon, with one transcription terminator on the plus strand 3′ to topA ( Fig. 7a ), one promoter on the 5′ side of dprA and one predicted promoter in the middle of the dprA ORF. Therefore, it was likely that dprA is co-transcribed with its neighbouring genes. Consistent with this observation, non-quantitative RT-PCR generated PCR products spanning dprA, smg and topA ( Fig. 7b ), while negative control reactions exhibited no detectable PCR product of similar size (data not shown). The dprA and topA genes are also co-localized in representative genomes from 14 of 24 bacterial phyla (Table S4). In Myxococcus xanthus, the dprA and topA genes are fused. dprA–smg co-localization is also found in other Neisseria species and in some Betaproteobacteria and Gammaproteobacteria. However, smg orthologues are only found in Betaproteobacteria and Gammaproteobacteria, with representation in E. coli, B. subtilis and Vibrio cholerae. In S. pneumoniae, dprA, topA and smg do not map to the same chromosomal region [70].

        RT-PCR analysis of the Neisseria meningitidis dprA gene cluster. (a) Organization of the genes in the gene cluster. Open reading frames are shown as open arrows. Predicted promoters are indicated by filled circles and the predicted terminator is indicated by an open circle. The position of the primer used for reverse transcription is shown by an arrow. PCR products numbered according to the lanes in (b) are given by lines, with diamonds indicating the primer positions. The figure is not to scale. (b) Agarose gel picture of the RT-PCR products. Molecular sizes are given at the sides. The lane numbering corresponds to the numbers in (a).


        Abstract

        The current increase in the incidence and severity of infectious diseases mandates improved understanding of the basic biology and DNA repair profiles of virulent microbes. In our studies of the major pathogen and model organism Neisseria meningitidis, we constructed a panel of mutants inactivating genes involved in base excision repair, mismatch repair, nucleotide excision repair (NER), translesion synthesis, and recombinational repair pathways. The highest spontaneous mutation frequency among the N. meningitidis single mutants was found in the MutY-deficient strain as opposed to mutS mutants in Escherichia coli, indicating a role for meningococcal MutY in antibiotic resistance development. Recombinational repair was recognized as a major pathway counteracting methyl methanesulfonate-induced alkylation damage in the N. meningitidis. In contrast to what has been shown in other species, meningococcal NER did not contribute significantly to repair of alkylation-induced DNA damage, and meningococcal recombinational repair may thus be one of the main pathways for removal of abasic (apurinic/apyrimidinic) sites and strand breaks in DNA. Conversely, NER was identified as the main meningococcal defense pathway against UV-induced DNA damage. N. meningitidis RecA single mutants exhibited only a moderate decrease in survival after UV exposure as opposed to E. coli recA strains, which are extremely UV sensitive, possibly reflecting the lack of a meningococcal SOS response. In conclusion, distinct differences between N. meningitidis and established DNA repair characteristics in E. coli and other species were identified.

        Neisseria meningitidis, or the meningococcus (MC), is a gram-negative inhabitant of the human oropharynx that may disseminate into the bloodstream and traverse the blood-brain barrier to cause septicemia and/or meningitis. MC cells residing on mucosal surfaces are exposed to DNA damaging agents, in particular, reactive oxygen species (ROS) generated from normal cellular metabolism or a highly effective immune system through the oxidative burst. ROS from exogenous and endogenous sources can induce a vast number of different types of DNA damage, including single- and double-strand breaks, abasic (apurinic/apyrimidinic, or AP) sites, and base damages, among which the oxidation product of guanine, 7,8-dihydro-8-oxo-2′-deoxyguanosine (8oxoG), is one of the most frequent (13). Oxidative DNA damage is primarily processed by the base excision repair (BER) pathway (52). In Escherichia coli, BER is initiated by DNA glycosylases that nick the N-glycosylic bond and remove the damaged base by a flipping mechanism. The remaining sugar and phosphate moieties are subsequently excised either by an AP-lyase activity inherent in many DNA glycosylases or by an AP endonuclease, leaving the processing of the 3′ or 5′ terminus, respectively, to a deoxyribose phosphodiesterase (52). A triplet of enzymes referred to as the GO system composed of the DNA glycosylases MutY and Fpg, as well as the nucleotide hydrolase MutT, is involved in limiting the mutagenic effects of 8oxoG (38).

        In contrast to the endogenous origin of BER lesions, nucleotide excision repair (NER) generally repairs bulky lesions due to stress from exogenous sources interfering with normal base-pairing and impairing transcription and replication (12). In E. coli NER is executed by the UvrABC complex which removes the stretch of nucleotides including the lesion (12, 51). The third excision repair pathway, mismatch repair (MMR), recognizes base-base mismatches and insertion/deletion loops, including those introduced by DNA polymerases. In E. coli MMR, MutS mismatch recognition (33, 43) is followed by MutL recruitment (2). Together, these enzymes activate MutH, an endonuclease that preferentially cleaves the unmethylated strand at hemimethylated GATC sites (3). Additional E. coli DNA repair pathways manage other classes of DNA lesions: double-stranded breaks are primarily repaired by E. coli recombinational repair by the RecABCD pathway (32). A key component, RecA, has the ability to homologously pair, via strand exchange, a damaged duplex with the intact sister duplex (32). Moreover, the binding of E. coli RecA to single-strand regions up-regulates the expression of the more than 40 genes of an inducible SOS system involved in repairing DNA damage and restoring replication (18). Damage tolerance in E. coli is further provided by daughter strand gap repair, as well as translesion synthesis (TLS) constituted by the three TLS DNA polymerases Pol II (8), DinB (58), and UmuDC′ (56) that allow replication past blocking lesions at the cost of mutations (40).

        The data available on MC DNA repair components have been derived primarily from genome sequences and experiments conducted in the close relative, Neisseria gonorrhoeae (the gonococcus) (11, 29). The only fully characterized MC DNA repair component to date is the BER DNA glycosylase MutY (10). MC homologues to other components of the BER pathway have been identified however, the genes encoding DNA glycosylase Nei and endonuclease Nfo are missing (29). An apparent functional MC NER pathway has also been identified since MC genomes harbor homologues of uvrA, uvrB, and uvrC genes (46, 57), and gonococcus NER activity has been experimentally confirmed (4). Additionally, MC genomes reveal the presence of MMR mutS (class I) and mutL homologues, while mutH and dam homologues are missing (46, 49, 57). Due to frequently occurring recombination, transformation, and antigenic variation, recombinational repair proteins, including RecA, are most important in the pathogenic Neisseria (11, 31). Although a recF homologue is missing, both the RecBCD and RecF-like pathways are implicated in DNA repair (37), and gonococcus RecA acts in both pathways (30, 37). In contrast, neither a LexA homologue nor SOS boxes have been detected in the MC or gonococcus genomes, and the lack of an inducible SOS response in the gonococcus has been experimentally confirmed (5). Additionally, homology searches have shown that MC genomes harbor only a single TLS DNA polymerase gene encoding the DinB homologue (11, 35).

        Infections caused by MC are associated with significant morbidity and mortality worldwide. However, very limited information exists on MC DNA repair and its influence on genome instability, strain variability, and pathogenesis (11). In this study, we investigated the potential interactions of BER with other DNA repair pathways. We constructed a panel of MC mutants to disrupt the expression of selected BER components and activity of MMR, NER, recombinational repair, and TLS, alone or in combination with BER. Single and double MC DNA repair mutants were assessed with regard to their spontaneous mutation and transformation rates, as well as survival after exposure to various DNA damaging agents. Our results indicate that the interactions between MC DNA repair pathways significantly differ from what has previously been documented in E. coli and other species.


        Neisseria meningitidis transformation into a pathogen - Biology

        In this book leading Neisseria authorities review the most important research on pathogenic Neisseria to provide a timely overview of the field. Topics covered include: the link between pathogenesis and important metabolic pathways vaccine development antibiotic resistance transcriptomics of regulatory networks regulatory small RNAs interactions with neutrophils and advances in humanized mouse models. An essential guide for research scientists, advanced students, clinicians and other professionals working with Neisseria, this book is a recommended text for all microbiology libraries.

        "a current overview on the most important research in the field." from Ringgold (February 2015).

        "leading Neisseria authorities review recent research on pathogenic Neisseria to provide a timely overview of the field . (recommended for) research scientists, advanced students, clinicians and other professionals working with Neisseria." from Fungal Diversity

        (EAN: 9781908230478 9781908230614 Subjects: [microbiology] [bacteriology] [medical microbiology] [molecular microbiology] [genomics] )


        Neisseria meningitidis

        N. meningitidis (the meningococcus) is a Gram-negative bacterium, and a major causative agent of bacterial meningitis and severe sepsis. Meningococcal infections are a leading cause of morbidity and mortality worldwide, therefore understanding their molecular biology is crucial to develop therapeutics such as vaccines.

        1 in 100,000 people will become infected with Neiserria meningitis every year, with the rate in children below the age of one at a staggering 30 cases per 100,000. N. meningitidis can be serotyped based on the similarity of their capsules. There are five serogroups of N. meningitidis commonly found colonising the human nasopharynx , these are: types A, C, W, Y and B. Distribution and carriage of these serogroups in the population varies over time, and understanding this distribution is important for informing meningococcal vaccination programmes. Serogroup B strains are particularly worrisome in children, and are one of the highest causes of mortality in this age group.

        Scanning electron microscope image of N.meningitidis

        This image shows the characteristic pairs of N. meninigitidis cells forming a diplococcus.

        N. meningitidis usually colonise the nasopharyx of roughly 10% of healthy individuals, but can go on to cause meningitis if they infect the otherwise sterile, protective membranes around the brain and spinal cord (meninges) or septicaemia if they find their way into the blood. Symptoms of meningococcal meningitis specifically, include: fatigue, fever, and headache but can rapidly progress to neck stiffness, coma and death. Meningococcal meningitis is the only form of the disease known to be transferred epidemically, usually in Africa and south east Asia. It is spread by coughing, sneezing, and expulsion of other respiratory secretions.

        N.meningitidis have many different factors contributing to their ability to cause disease. These include the lipooligosaccharide component of its out membrane, which acts as a toxin against red blood cells (the main cause of septic shock and haemorrhage). You can find a useful review of the many molecular mechanisms contribution to the pathogenicity of Neisseria meningitidis here.

        Here at UoL we're interested in the genetics of Neisseria meningitidis, and in particular the way it can switch expression of some of its genes on and off, a phenomenon known as phase variation. This process allows the bacterium to rapidly generate diversity in response to the hostile environment of the human host. Click here to read more about phase variation and take our tutorial investigating the contribution of phase variation to disease cause by N. meningitidis.

        Neisseria meningitidis-
        • The major causative agent of bacterial meningitis.
        • Key virulence factors include the surface adhesins Opa and Opc, and an IgA protease.


        Chapter 10: PCR for Detection and Characterization of Bacterial Meningitis Pathogens: Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae

        1. Overview of PCR technologies In developing countries, the most commonly used approaches for detection and characterization of bacterial meningitis pathogens include culture, Gram stain, and latex agglutination. Although culture is considered the gold standard for case confirmation in clinics, the positive rate is relatively low due to suboptimal storage and transportation conditions, culture practice, and/or antibiotic treatment administered before the specimen is collected. While Gram staining is important, inexpensive, and should be performed whenever possible, it merely gives a clue as to the genus and species of the etiological agent. The reading of latex agglutination results is subjective and can be difficult to interpret, especially when a specimen&rsquos bacterial load is low. It is also not feasible to do quality control on latex agglutination. Culture should be kept as the gold standard as cultured bacteria are sources of data for antibiotic susceptibility, complete subtyping, the expression of antigens that are to be included in future vaccines, and pathophysiology of isolates. Specimens that do not yield any culture can still be analyzed by molecular methods (see below) that can be applied on DNA extracted from clinical specimens (typically, blood and CSF).
          1. Polymerase chain reaction (PCR) PCR was developed in the mid- to late 1980s (36, 42) and is considered one of the most important methodological inventions in molecular biology. It is designed to permit selective amplification of a specific target DNA sequence(s) within a heterogeneous collection of DNA sequences (e.g., total genomic DNA). In PCR, the DNA target is exponentially amplified through repeating three major steps: 1) denaturation of double-stranded DNA into single-stranded DNA 2) annealing of primers to the complementary single-stranded target sequences and 3) extension of the primers in the 5&prime to 3&prime direction by heat-stable DNA polymerase to produce double-stranded DNA molecules. The copy number of DNA molecules is doubled in each extension step, generating millions of copies of the original DNA molecules when PCR is completed. Because the method does not require live or intact cells, PCR is a valuable tool for detecting bacterial pathogenic agents from clinical specimens, where bacteria die or lyse easily due to inappropriate storage conditions or prior antibiotic treatment. PCR is now widely used in the diagnosis and surveillance of bacterial pathogens because of its high sensitivity and specificity and high throughput capabilities. It provides a complementary tool to classic phenotype-based methods such as culture, Gram stain, and latex agglutination and often enhances confirmatory results (3).A number of conventional PCR assays have been developed for detection and subtyping of bacterial and viral pathogens. Conventional PCR detects products at the end point of DNA amplification by visualizing amplicons using agarose gel electrophoresis. Gel-based detection requires that tubes containing PCR amplicons be opened and manipulated, thereby greatly increasing the risk of contamination of laboratory space, equipment, and reagents with amplified materials. Conventional PCR is also very time consuming and less sensitive and specific than a type of PCR called real-time PCR, so it is primarily used for typing assays employing purified cultures or clinical specimens that contain the organism in high density. The use of real-time PCR is rapidly expanding because it is easier to perform and, being a closed system, it reduces potential contamination problems inherent to conventional PCR. Many of the same precautions mentioned for conventional PCR assays also apply to real-time PCR assays.
          2. Real-time PCR technology Real-time PCR is also known as quantitative real-time polymerase chain reaction (Q-PCR/qPCR) or kinetic polymerase chain reaction, which combines amplification and detection in one step through the use of fluorescent dyes. There are two types of detection systems: non-specific and specific. Non-specific detection systems use a fluorescent dye that intercalates into any double-stranded DNA molecules and emits enhanced fluorescence. This detection system is relatively inexpensive but susceptible to false positivity. Specific detection systems rely on fluorescent resonance energy transfer probes that specifically recognize target sequences, thus making them the systems of choice for the molecular detection assays described here. Specific detection systems are more expensive than non-specific detection systems and require sophisticated probe designs. Three types of probes are currently in use, including: hydrolysis, hybridization, and hairpin probes (7, 13). A fluorescent signal is only generated if the probe interacts with its specific target and is subsequently hydrolyzed during amplification. The resulting increase in fluorescence is proportional to the amount of amplified PCR product in the reaction.The first use of dual-labeled hydrolysis probes was reported in 1993 (30) and has been widely used in many laboratories since that time. A dual-labeled hydrolysis probe is an oligonucleotide (

          Figure 1. Chemistry of a dual-labeled hydrolysis probe. view larger image icon

            Species-specific real-time PCR assays PCR detection of N. meningitidis, H. influenzae, and S. pneumoniae can be achieved by amplification of several potential gene targets (8, 35, 53, 60). The following assays have been developed and validated to be used on DNA extracted from clinical specimens (typically, blood and CSF) and bacterial isolates.
          N. meningitidis

          Two genes can be targeted in N. meningitidis species-specific assays, ctrA and sodC. The capsule transport to cell surface gene, ctrA, is highly conserved among isolates responsible for invasive meningococcal infections and has been used in both real-time and conventional PCR to detect N. meningitidis (35). It is a gene within the capsule locus (Figure 2). However, since at least 16% of carried meningococci lack ctrA (10, 14, 41), a real-time PCR assay to detect all meningococci, regardless of encapsulation status, was recently developed and validated (15). This assay targets the Cu, Zn superoxide dismutase gene, sodC, which is not genetically linked to the capsule locus. The sodC assay detects encapsulated meningococci, but it is also useful for detecting nongroupable meningococci that do not contain an intact ctrA, as will be recovered during carriage studies. For this reason, it is recommended that sodC be used for detection of N. meningitidis, if possible. sodC and ctrA primers and probes are listed in Table 2.

          H. influenzae

          The protein D encoding gene, hpd, encodes protein D, a highly conserved, surface-exposed lipoprotein that is present in all encapsulated and non-encapsulated H. influenzae (24, 45). The conserved nature of this gene and its presence in all strains of H. influenzae characterized to date make it a highly attractive gene target for the development of a H. influenzae species-specific real-time PCR assay. The recently developed and validated hpd real-time PCR assay is capable of detecting all six serotypes (a-f) and nontypeable (HiNT) H. influenzae with high sensitivity and specificity (60). Real-time PCR assays targeting bexA were developed and distributed because bexA is present in all six serotypes of H. influenzae. However, though sensitive for detection of Hib, it is less sensitive for Hia, Hic, and Hid, and does not detect Hie, Hif, or HiNT and should no longer be used. The primers and probes for the hpd assay are listed in Table 2.

          S. pneumoniae

          Both conventional and real-time PCR assays have been developed for the detection of S. pneumoniae, and target genes have included the pneumolysin (ply), autolysin (lytA), and pneumococcal surface adhesion (psaA) genes (8). However, false-positive results with ply-based PCR have been reported when applied to upper respiratory tract specimens. A suggested explanation for these false positives is the detection of non-pneumococcal alpha-hemolytic streptococci (37, 47), which are normally present in the respiratory flora (e.g., Streptococcus mitis group and Streptococcus oralis) which sometimes contain a ply gene (62). The PCR detection assay for S. pneumoniae using a specific segment of the autolysin gene (lytA) is recommended because it is highly conserved within the species and it has been shown that this assay bestseparates S. pneumoniae from the genotypically similar species S. mitis, S. oralis, and S. pseudopneumoniae (33). The real-time PCR assay lytA primers and probes that have been found to be extremely reliable for detection of S. pneumoniae are listed in Table 2. Due to recombination events that occur between pneumococci and closely related streptococci, there will probably be rare false-positives or false-negatives for virtually any real-time assay for pneumococcal identification.

          N. meningitidis

          N. meningitidis is classified into 12 serogroups on the basis of the chemical composition and linkage type of saccharide subunits of the capsular polysaccharide that are expressed on the bacterial cell surface. Major disease-causing serogroups include A, B, C, Y, and W135, the latter four of which produce sialic acid containing capsular polysaccharides whereas serogroup A produces a poly-&alpha1-6-linked N-acetylmannosamine 6-phosphate capsule (31). Outbreaks caused by serogroup X meningococci, which express poly-&alpha1-4-linked N-acetylglucosamine 1-phosphate capsule (6) have also been reported (2, 20). Serogroup D is no longer recognized as a serogroup of N. meningitidis.

          As illustrated in Figure 2, the genetic organization of the capsule locus is conserved among the serogroups. The capsule expression genes are located in four operons: one that encodes capsule biosynthesis (called syn or sia genes, depending on which nomenclature system is used) and three that encode the capsule transport to the cell surface proteins (ctr). The gene products of the ctr operon share high similarity with the ATP-dependent transporters of the ABC family (19) and are highly conserved among the major disease-causing serogroups (1, 18, 39, 55) and serogroup X (56). Sensitive real-time PCR assays targeting ctrA, which is the first gene in the capsule transport operon, have been developed for detection of all encapsulated and some non-encapsulated (nongroupable) N. meningitidis (12, 35), though a more specific and sensitive assay using the sodC gene as a target has been developed. The genetic differences among the capsule biosynthesis operons of meningococcal serogroups have facilitated the development of real-time PCR assays targeting serogroup-specific genes for capsule biosynthesis to determine the capsule genotype of a meningococcal isolate (35).

          The gene sia (for sialic acid biosynthesis (16, 22), also called syn forcapsule biosynthesis (21, 51), are used for genotyping for serogroups B (synD), C (synE), Y (synF) and W135 (synG). The sacB gene is targeted for serogroup A and the xcbA gene, which most likely encodes the capsule polymerase, is targeted for serogroup X (2, 35). These target genes are depicted within the structure of the capsule gene complex for serogroups A, B, C, Y, W135, and X (Figure 2). The most current adapted primer and probe sequences for the serogrouping real-time PCR assays are listed in Table 3, though, periodically, the primers and probes are adapted as new information regarding probe chemistries and allelic variations become available.

          There have been several different systems in place for naming the genes for meningococcal capsule biosynthesis. Some groups have called this operon syn for capsule biosynthesis (21, 51) other groups have used the sia nomenclature for sialic acid biosynthesis (16, 22) still others have referred to them as neu genes based on homologies to E. coli K1 genes for N-acetylneuraminic acidbiosynthesis (21). While the siaD genes of serogroups B, C, W135, and Y were initially thought to be alleles, more extensive sequencing analysis demonstrated that this is not so. The synD and synE genes of serogroups B and C, respectively, are alleles and encode capsular polysaccharide polymerases that catalyze different linkages of sialic acid monomers (&alpha2&rarr8 linkage for serogroup B and &alpha2&rarr9 linkage for serogroup C). However, the Y and W135 genes are over twice the size of the B and C genes and differ in nucleotide sequence (11, 50), though they are highly similar to each other. In addition, the polymerases for serogroups Y and W135 link heteropolymers of sialic acid plus either glucose or galactose, respectively. Thus, the capsular polysaccharide polymerase genes of serogroups Y and W135 are alleles. To continue to call all of these polymerase genes siaD would be a misnomer. For these reasons and for simplicity, this text will use the synABCD/E/F/G nomenclature listed above and in Table I.

          Table 1. Serogroup capsule type and gene targets for genotyping real-time PCR assays

          Table 1. Serogroup capsule type and gene targets for genotyping real-time PCR assays
          Sero-group Capsule type Gene Target Name Alternate Gene Names Ref
          A (&alpha1&rarr6)-N-acetyl-D-mannosamine-1-phosphate sacB (31)
          B (&alpha2&rarr8)- N-acetylneuraminic acid synD siaD
          siaD
          of B
          siaDB
          (5, 9, 23, 48, 61)
          C (&alpha2&rarr9)- N-acetylneuraminic acid synE siaD of C
          siaDC
          (5, 9, 50, 58, 61)
          W135 6-D-Gal(&alpha1&rarr4)-N-acetylneuraminic acid(&alpha2&rarr6 synG siaD of W135
          siaDW
          (4, 9, 14, 35, 49, 61)
          X (&alpha1&rarr4)-N-acetyl-D-glucosamine-1-phosphate xcbB (2, 6)
          Y 6-D-Glc(&alpha1&rarr4)-N-acetylneuraminic acid(&alpha2&rarr6) synF siaD of Y
          siaDY
          (4, 9, 14, 35, 49, 61)

          For serogroups B, C, Y and W135, the first three genes of the syn operon encode functions for the synthesis of capsule polysaccharide precursors (32, 48, 51). The fourth gene product is a polymerase that catalyzes the formation of polymers with the serogroup-specific linkage. In serogroups B and C, the products of a four-gene operon (synABC plus the polysialyltransferase gene synD [Nmen B] or synE [Nmen C]) are responsible for biosynthesis of the sialic acid (also known as N-acetylneuraminic acid, NeuNAc, or NANA) homopolymer. Expression of the poly-N-acetylmamosamine-1-phosphate capsule polymer of serogroup A requires the sacABCD operon (formerly known as mynABCD (49), while expression of the poly-N-acetyl-D-glucosamine-1-phosphate capsule of serogroup X requires the xcbABC operon.

          Figure 2. Genetic maps of the capsule gene complex (cps) of N. meningitidis (adapted from (14)). The ctrABCD operon encodes ATP-dependent export proteins (grid pattern). synABC (solid gray) D/E/F/G (dotted), sacABCD (horizontal striped), and xcbABC (dashed upward diagonal), encode the serogroup-specific enzymes for capsule polymer biosynthesis. oatC (serogroup C) and oatWY (serogroups W135 and Y), are co-transcribed with the syn operons and encode O-acetyltransferases (9). lipA and lipB code for proteins that were originally proposed to add a phospholipid-anchoring group onto the polysaccharide reducing end before transport (19). ctrE and ctrF (diagonal brick), formerly known as lipA and lipB, respectively, are involved in capsule transport (57). These gene products were once thought to be involved in post-polymerization modification. Many nongroupable, carried meningococci lack all or part of the capsule locus (10, 14) those lacking the entire locus have a genetic configuration at this position like those of N. gonorrhoeae and N. lactamica, which are not known to synthesize capsule. view larger image icon

          Haemophilus influenzae

          The capsule locus of all six serotypes of H. influenzae (Hi a, b, c, d, e, and f) consists of three regions encoding functions for capsule polysaccharide synthesis, modification, and translocation (Figures 3 and 4) (25, 43, 44). bexDCBA in the ATP-driven export region (also known as Region I) code for protein components of an ATP-driven polysaccharide export apparatus. hcsA and hcsB in post polymerization modification region (also known as Region III) share high similarity with lipA and lipB (recently renamed ctrE and ctrF), respectively, which are involved in modification and export of meningococcal capsule polysaccharide (43). Both regions are common to all serotypes. The same nomenclature is used for genes in the two regions for all six serotypes. The serotype-specific region (previously Region II) contains genes for capsule synthesis and is unique to each serotype. The serotype-specific genes are named acs, bcs, etc. for &ldquoa capsule synthesis&rdquo, &ldquob capsule synthesis&rdquo, and so on.

          The cap locus encodes functions for H. influenzae capsule synthesis. The genetic organization of the cap locus has been well characterized in Hib and Hif, which belong to two phylogenetic divisions that are defined by multilocus enzyme electrophoresis typing. The ATP-driven export region includes most of Hia and Hib strains, and all of Hic, Hid, and Hie strains. Strains from this region have at least one completed cap locus flanked by insertion sequence (IS) element IS1016, except Hie. The majority of Hib strains and some Hia strains from this region have the direct-repeat configuration with the second copy of the bexA gene partially deleted as illustrated in Figure 4. The truncated cap locus is not required for capsule synthesis (26&ndash28). In Hif, Hib, and Hia strains of the serotype-specific region and some Hie strains of the ATP-driven export region, the cap locus is flanked by sodC and HI1637 (26, 44).

          While serotype b causes the vast majority of H. influenzae disease in countries without a Hib vaccination program, serotypes a, c, d, e, and f, and nontypeable H. influenzae (NTHi), also contribute to case numbers (43, 59). As implementation of Hib vaccine becomes more widespread, it is important to monitor incoming specimens for both b and non-b serotypes of H. influenzae. Therefore, serotype-specific real-time PCR assays have been developed that target the serotype-specific region genes where possible, or the 5&prime end of bexD, which is less conserved among the serotypes compared with the other genes in the export region. The genes targeted for real-time PCR assays specific to each serotype are as follows: acsB (Hia), bcsB (Hib), ccsD (Hic), dcsE (Hid), ecsH (Hie), and bexD (Hif) (Figure 3). The primer and probe information for each of these serotyping assays can be found in Table 4. Each of these assays has been shown to be highly specific and sensitive for their respective serotypes.

          Figure 3. Capsule loci for H. influenzae serotypes a, b, c, d, e, and f, including the target genes for serotype-specific real-time PCR assays. The capsule locus of all six serotypes of H. influenzae (Hia-f) consists of three regions encoding functions for capsule polysaccharide synthesis, modification, and translocation. bexDCBA in the ATP-driven export region (white arrows) code for protein components of an ATP-driven polysaccharide export apparatus. hcsA and hcsB are in the post polymerization modification region (gray arrows) and may be involved in the modification and export of capsule polysaccharide. The serotype-specific region (colored arrows) contains genes for capsule synthesis and is unique to each serotype. The serotype-specific genes are named acs, bcs, etc. for "a capsule synthesis", "b capsule synthesis", and so on. With the exception of the Hif serotype-specific assay, the target genes for the serotype-specific assays can be found in this region and are highlighted by the red boxes. view larger image icon

          Figure 4. Genetic organization of the cap locus in Hib (adapted from (43)). Partially duplicated cap locus of Hib Hi 1007 showing the truncated ATP-driven export region with the 1.2-kb deletion between IS1016 and bexA. view larger image icon

          Multiplex conventional PCR assays for serotyping S. pneumoniae

          A multiplex PCR-based serotyping scheme that includes 40 serotype specificities has been developed (38). This PCR approach has the potential to greatly reduce reliance upon conventional serotyping and provides serotype-determining potential to laboratories that lack type-specific antisera and other reagents needed for conventional serotyping, yet have the equipment necessary for DNA amplification and electrophoresis.

          The multiplex approach uses 9 reactions to identify 40 serospecificities (Table 5 for primers, Tables 6&ndash8 for schemes, and Figure 5 for PCR products) but also provides some flexibility that allows for altering combinations of serotypes included in each sequential reaction. These can be modified based on the most prevalent serotypes in any given geographic region but do require validation to ensure no cross reaction between serotype primer sets. Three such schemes based upon pneumococcal serotype prevalence in the USA, Africa, and Latin America have been designed (Tables 6&ndash8). These schemes will continue to be refined as additional serotypes are added and primer sets updated to improve specificity and sensitivity. The most current methods are described at the CDC Streptococcus website and should be consulted on a regular basis

          Real-time PCR assays for serotyping S. pneumoniae

          A number of real-time PCR assays for serotyping S. pneumoniae have been published in the literature and others are being developed (34, 40). These real-time assays are recommended for determining serotypes from clinical specimens when DNA may be present in low amounts and insufficient for conventional multiplex PCR serotyping. Please see the Streptococcus Laboratory website for an example.

          • Equipment
            • Microcentrifuge with refrigerating function
            • Water bath or dry block heater
            • Vortexer
            • Freezer
            • Refrigerator
            • pH meter
            • Balance
            • Stir plate
            • 10% bleach (10:1, water: concentrated bleach) (make fresh weekly)
            • 70% ethanol
            • 1.5 ml microcentrifuge tubes (sterile, DNAase free, or PCR grade)
            • 1 set of micropipettors (1-10 µl, 2-20 µl, 20-200 µl, and 100-1000 µl)
            • Pre-sterilized filter tips (10 µl, 200 µl, and 1000 µl)
            • TE Buffer (10 mM Tris HCl, pH 8.0, 1 mM EDTA)
            • Tris buffer (10 mM Tris HCl, pH 8.0)
            • Lysozyme
            • Mutanolysin
            • Proteinase K (20 mg/ml)
            • Lysis buffer (4% SDS, 10 mM EDTA pH 8.0)
            • Digestion buffer
            • Phenol
            • Chloroform
            • Phenol: chloroform (1:1)
            • Commercial DNA extraction kits are available for culture and blood and body fluids
            • Commercial PCR Master Mix containing dNTPs and DNA polymerase is available
            EDTA, 0.1 M, pH 8.0 (100ml)
            1. Dissolve 3.7 g EDTA in 70 ml distilled deionized H2O (ddH2O).
            2. Adjust pH to 8.0 with 10 M NaOH.
            3. Add ddH2O to 100 ml.
            4. Autoclave at 121°C for 20 minutes.
            5. Store at room temperature.
            Tris-HCl, 0.1 M, pH 8.0
            1. Dissolve 1.2 g Tris base in 80 ml ddH2O.
            2. Adjust to pH 8.0 with concentrated HCl.
            3. Mix and add ddH2O to 100 ml.
            4. Autoclave at 121°C for 20 minutes.
            5. Store at room temperature.
            Tris-HCl, 0.1 M, pH 7.6
            1. Dissolve 1.2 g Tris base in 80 ml ddH2O.
            2. Adjust to pH 7.6 with concentrated HCl.
            3. Mix and add ddH2O to 100 ml.
            4. Autoclave at 121°C for 20 minutes.
            5. Store at room temperature.
            20% Sodium dodecyl sulfate (SDS)*
            1. Dissolve 20 g SDS in 100 ml sterile ddH2O.
            2. Place the container into a 50-607°C water bath to facilitate dissolving.
            3. Avoid vigorous shaking that generates bubbles.
            4. Store at room temperature.

            *Eye and respiratory protection should be worn when weighing powdered SDS.

            TE buffer (10 mM Tris HCl, pH 8.0, 1 mM EDTA)
            1. Add 10 ml of 0.1 M Tris-HCl, pH 8.0.
            2. Add 1 ml of 0.1 M EDTA, pH 8.0.
            3. Add sterile ddH2O to 100 ml and mix well.
            4. Store at room temperature.
            Tris-HCl buffer (10 mM, pH 8.0)
            1. Add 10 ml of 0.1 M Tris-HCl.
            2. Add 90 ml sterile ddH2O and mix well.
            3. Store at room temperature.
            Lysis buffer (4% SDS, 10 mM EDTA pH 8.0)
            1. Add 20 ml of 20% SDS.
            2. Add 10 ml of 0.1 M EDTA pH 8.0.
            3. Add sterile ddH2O to 100 ml and mix well.
            4. Store at room temperature.
            Mutanolysin stock solution (2,500 U/ml)
            1. Reconstitute the entire bottle of mutanolysin with sterile ddH2O to produce a concentration of 2,500 U/ml.
            2. Aliquot into sterile screw-top microcentrifuge tubes.
            3. Store aliquots at -20°C.
            Digestion buffer (0.04 g/ml lysozyme and 75 U/ml mutanolysin in TE buffer)
            1. For 1 ml of TE buffer containing lysozyme and mutanolysin, add 40 mg lyophilized lysozyme to a 1.5 ml microcentrifuge tube.
            2. Add 1 ml TE buffer.
            3. Add 30 µl of a stock solution of mutanolysin at 2500 U/ml.
              • This solution should be prepared &le 15 minutes prior to use and should not be reused.
            Proteinase K (20 mg/ml)
            1. Dissolve 200 mg of proteinase K powder in 10 ml of sterile ddH2O.
            2. Aliquot 1 ml into microcentrifuge tubes.
            3. Store at -20°C.
            Hyaluronidase (30 mg/ml)
            1. Dilute 100 mg in 3.3 ml sterile ddH2O to make 30 mg/ml solution.
            2. Dispense in 500 µl aliquots store at -20°C.
            Sodium acetate (3.0 M, pH 5.5)
            1. Dissolve 40.8 g sodium acetate in 80 ml sterile ddH2O.
            2. Adjust pH to 5.5 with glacial acetic acid.
            3. Add sterile ddH2O to final volume of 100 ml.
            4. Autoclave at 121°C for 20 minutes.
            5. Store at room temperature.
            Phenol: chloroform (1:1)
            1. Melt solid or liquified phenol in a 68°C water bath. Liquified phenol should be stored at -20°C.
            2. Mix equal volumes of phenol and chloroform.
            3. Add an equal volume of 0.1 M Tris-HCl pH 7.6 to the phenol.
            4. Mix for 15 minutes and place the bottle back to water bath to allow the phases to separate.
            5. Remove the top aqueous layer as much as possible.
            6. Repeat step b-d until the top aqueous layer reaches

            N. meningitidis and H. influenzae (gram-negative)

            1. Dispense 1.0 ml of 10 mM Tris (pH 8.0) buffer into 1.5 ml microcentrifuge tubes and label.
            2. Harvest colonies from 18-24 hour pure cultures of H. influenzae or N. meningitidis using a sterile polyester or rayon-tipped swab and swirl the swab in the Tris buffer to make a turbid suspension (equivalent to a McFarland 3.0 standard). Be careful not to pick up pieces of agar on the swab.
            3. Vortex briefly and boil cell suspension at 100°C for 10 minutes.
            4. Proceed immediately with PCR or store at -20°C.
            Fast DNA extraction protocol for S. pneumoniae (gram-positive)
            1. Dispense 300 µl of 0.85% NaCl into 1.5 ml microcentrifuge tubes and label.
            2. Harvest colonies (use 1 loopful of a 10 µl loop) from 18-24 hour pure cultures of S. pneumoniae using a sterile polyester or rayon-tipped swab and swirl the swab in the 0.85% NaCl to make a turbid suspension (equivalent to McFarland 3.0 standard). Be careful not to pick up pieces of agar on swab.
            3. Vortex briefly and incubate at 70°C for 15 minutes.
            4. Microcentrifuge at 12,000 x g for 2 minutes and remove the supernatant.
            5. Re-suspend in 50 µl TE buffer (10 mM Tris-HCl, 100 µM EDTA, pH 8.0) and add 10 µl mutanolysin (3000 U/ ml)* and 8 µl of hyaluronidase (30 mg/ml)**
            6. Incubate at 37°C for 30 minutes up to 18 hours (overnight).
            7. Heat-inactivate the enzymes in the suspension by boiling at 100°C for 10 minutes.
            8. Microcentrifuge at 12,000 x g for 4 minutes and remove supernatant for use as DNA template.
            9. Proceed immediately with PCR or store at -20°C.

            Footnotes

            *Mutanolysin (10,000 U). Dilute in 3.3 ml of TE buffer to make 3000 U/ml stock solution, store at -20°C as 500 µl aliquots.

            **Hyaluronidase (100 mg). Dilute in 3.3 ml of TE buffer to make 30 mg/ml solution, store at -20°C as 500 µl aliquots.

              Bacterial cell lysis The first step in extracting and purifying bacterial DNA is to lyse the bacterial cell walls for maximum DNA yield. There are multiple ways to lyse bacterial cells, either physically or chemically, and this step can be optimized by considering the suspected bacteria and starting specimen material, as well as the materials available to each laboratory. Chemical or enzymatic based lysis methods are typically simpler to perform and can be more cost efficient. Both N. meningitidis and H. influenzae are Gram negative and can be effectively lysed using lysis buffer containing protease such as Proteinase K along with a detergent. Incubation temperature and duration vary between organisms and specimen material. The optimal temperature range for Proteinase K activity is between 55-65°C. At temperatures above 65°C, the enzyme activity decreases. However, specimens incubated at 37°C can be left for longer incubation periods without affecting DNA quality. Specimens should be incubated until cells are completely lysed (when solution clears) and the time will vary between specimens. Once the bacteria are completely lysed one should proceed to the next step.For optimal yields of S. pneumoniae, which is gram-positive, additional enzyme digestion with lysozyme and mutanolysin will help to degrade the higher content of peptidoglycan in the cell wall before being lysed with buffer. The temperature and length of the enzyme incubation will depend on the concentration and type of enzyme used, as well as the lysis buffer used. High temperature incubation and repeated freeze/thaw cycles are generally used with higher concentrations of cells, such as when extracting from cultures. Physical lysis can be performed using a liquid or pressure cell homogenizer, sonication, or shaking with glass beads, although some of these methods will require additional and sometimes costly equipment and they tend to shear the DNA in to smaller fragments.

            Enzyme lysis for clinical specimens of unknown etiology or known gram-positive cell suspensions (S. pneumoniae)

            1. Prepare digestion buffer (0.04 g/ml lysozyme and 75 U/ml mutanolysin in TE buffer).
              • This solution should be prepared &le 15 minutes before use and not reused.
            2. Add 100 µl of digestion buffer to each microcentrifuge tube.
            3. Add 200 µl of bacterial cell suspension or clinical specimen to each microcentrifuge tube. Vortex and incubate at 37°C for 1 hour.
              • If specimen volume is less than 200 µl, note the volume in lab records and add TE buffer to a total volume of 200 µl. If the specimen tube appears to be empty, wash the sides of the tube with 200 µl TE buffer.
            4. Add 200 µl of cell lysis buffer to each microcentrifuge tube.
            5. Add 20 µl of Proteinase K (20 mg/ml) and invert each tube until the phases are completely mixed.
            6. Incubate at 37°C for 30 minutes to 1 hour.
            7. Purify DNA before using in real-time PCR reactions.

            Enzyme lysis for known gram-negative clinical specimens or cell suspensions (N. meningitidis and H. influenzae)

            1. Prepare cell lysis buffer (4% SDS, 1 mM EDTA pH 8.0).
            2. Add 200 µl of lysis buffer to each microcentrifuge tube.
            3. Add 200 µl of bacterial cell suspension or clinical specimen (CSF, serum, or blood) to each microcentrifuge tube.
            4. Add 20 µl of Proteinase K (20 mg/ml) for a final concentration of 1 mg/ml and invert each tube until the phases are completely mixed.
            5. Incubate at 37°C for 30 minutes to 1 hour.
            6. Purify DNA before using in real-time PCR reactions.

            Preparation of buffy coat

            1. Centrifuge the blood specimen at 2,500 x g for 10 minutes at room temperature.
            2. Three layers should be apparent after centrifugation. The top layer should be clear and contains plasma. The light tan middle layer is the buffy coat and contains concentrated leukocytes. The bottom red layer contains erythrocytes.

            Phenol/Chloroform to remove cell debris and proteins

            Phenol is a hazardous organic solvent and safety precautions should be taken when working with phenol. Always use suitable chemical protection gloves when handling phenol containing solutions. Specific waste procedures may be required for the disposal of solutions containing phenol.

            1. To a lysed specimen, add an equal volume of phenol: chloroform solution (1:1). Mix well by inversion or briefly vortex.
            2. Centrifuge the tube at 16,000 x gfor 15 minutes in a microcentrifuge.
            3. Carefully remove the top aqueous layer from the bottom phenol layer and transfer to a new tube, being careful to avoid the interface.
            4. Steps 1-3 can be repeated until an interface is no longer visible.
            5. To remove all traces of phenol, add an equal volume of chloroform to the aqueous layer and centrifuge the tube at 16,000 x gfor 15 minutes in a microcentrifuge.
            6. Carefully remove the top aqueous layer from the bottom chloroform layer and transfer to a new tube, being careful to avoid the interface.
            7. Steps 5-6 can be repeated until an interface is no longer visible.
            8. Precipitate the DNA by ethanol or isopropanol.

            Precipitation of DNA by ethanol or isopropanol

            1. Add a 0.1 (1/10th) volume of 3.0 M sodium acetate (pH 5.5) to the aqueous phase and then 2 volumes of 95% ethanol. Incubate at -20°C overnight or for shorter periods at -80°C (e.g. 20-30 minutes). Proceed with step 3.
            2. If isopropanol is used: Add a 0.1 volume of 3.0 M sodium acetate (pH 5.5) to the aqueous phase and then 0.6 volumes of 100% isopropanol. Incubate at -20°C for 2 hours or for shorter periods at -80°C (e.g., 10-20 minutes).
            3. Centrifuge at 16,000 x g for 30 min at 4°C.
            4. Recover the precipitated DNA by centrifuging the tube at 16,000 x g for 15 minutes at 4°C. Remove the aqueous phase with care.
            5. Add 2 volumes (of original sample) of 75% (v/v) ethanol and leave at room temperature for 5-10 minutes to remove excess salt and traces of phenol and chloroform from the pellet.
            6. Centrifuge at 16,000 x g for 5 minutes. Remove with care as much ethanol as possible from the microcentrifuge tube using a filtered pipette tip to avoid dislodging the pellet.
            7. Dry the DNA pellet in air, in a desiccator, or in a 50°C oven for 5 minutes.
            8. The dried DNA may be dissolved in sterile Tris buffer (10mM Tris-HCl, pH 8.0) and stored at 4°C for further manipulation or at -20°C for long-term storage.

            Extracted and purified DNA should be stored in a designated elution buffer from a commercial kit or in Tris buffer (10 mM Tris-HCl, pH 8.0). Distilled water can also be used but these specimens may experience degradation from acid hydrolysis. DNA can be kept at 4°C for short periods of time and at -20°C for long-term storage.

            1. Add 120 g of guanidinium isothiocyanate (GuSCN) to 100 ml of 0.1 M Tris/HCl (pH 6.4) and 22 ml of 0.2 M EDTA (pH 8.0) and 2.6 g of Triton X-100.
            2. Stir overnight in the dark to dissolve.
            3. Store away from light for up to 1 month.
              • GuSCN is toxic and care should be taken when handling this substance.
            1. Add 120 g of guanidinium isothiocyanate (GuSCN) to 100 ml of 0.1 M Tris/HCl (pH 6.4).
            2. Stir overnight in the dark to dissolve.
            3. Store away from light for 1 month.
            1. Add 60 g of silicon dioxide to 500 ml of distilled water in a graduated cylinder and leave at room temperature for 24 hours.
            2. Remove and discard 430 ml of supernatant and re-suspend solids in 500 ml of ddH2O.
            3. Leave at room temperature for 5 hours and remove and discard 440 ml of supernatant.
            4. Add 600 µl of concentrated HCl (pH 2.0), mix, and aliquot into 1.5 ml volumes.
            5. Sterilize by autoclaving and store away from light for up to 6 months.
            1. Add 100 µl of specimen (bacterial suspension or clinical specimen) to 500 µl of L6 extraction buffer and 10 µl of size fractionated silica in a 1.5 ml microcentrifuge tube. For double volumes of specimen, double the amount of L6 extraction buffer and silica, as well as reagents in the wash steps (L2 extraction buffer, ethanol and acetone).
            2. Vortex the tube for 10 seconds and incubate, with shaking, at room temperature for 15 minutes.
            3. Centrifuge the tube for 15 seconds at 16,100 x g and dispose of the supernatant.
            4. Wash the pellet two times with 500 µl L2 extraction buffer, two times with 500 µl of 70% ethanol and one time with 500 µl of acetone. Centrifuge for 15 seconds at 16,100 x g after each wash and dispose of the supernatant following appropriate procedures for chemical waste.
            5. To remove the acetone, place the tube with the lid open at 56°C in a dry heating block for 5 minutes.
            6. Elute the nucleic acid from the silica by adding 30 µl of distilled water, close the tube, vortex, and incubate at 56°C for 15 minutes.
            7. Centrifuge the tube at 16,100 x g for 2 minutes and collect the supernatant, taking care not to include any silica. The extracted DNA can be stored at 4°C overnight or at -70°C for long-term storage.
            • PCR thermocycler
            • Unventilated biocontainment cabinet or PCR hood
            • Freezer
            • Refrigerator
            • Electrophoresis tank
            • Power supply
            • Stir plate
            • Microwave oven
            • Gel viewing system
            • Gel documentation system
            • 10% bleach (10:1, water: concentrated bleach) (make fresh weekly)
            • 70% ethanol
            • 1.5 mL microcentrifuge tubes (sterile DNase free or PCR grade)
            • 96 well polypropylene plates, tube strips or individual
            • 1 set of micropipettors (1-10 µl, 2-20 µl, 20-200 µl, and 100-1000 µl)
            • Pre-sterilized filter tips (10 µl, 200 µl, and 1000 µl)
            • Optical caps
            • DNA polymerase
            • dNTPs
            • Primers Positive and negative control DNA diluted to approximately 5 µg/ml
            • PCR grade water
            • TAE or TBE buffer
            • Agarose powder (molecular biology grade)
            • DNA ladder
            • 6x DNA loading dye
            • Ethidium bromide
            • Bromophenol blue
            • Xylene cyanol FF
            • Sucrose

            1. Dissolve 18.6 g EDTA in 70 ml ddH2O.
            2. Adjust pH to 8.0 with 10 M NaOH (

            Ethidium bromide (EtBr), 10 mg/ml

            1. Dissolve 0.2 g ethidium bromide in 20 ml ddH2O.
            2. Mix well and store at 4°C in the dark in 1 ml aliquots.
            3. Store at room temperature.

            TAE (Tris/acetate/EDTA) electrophoresis buffer, 50 X stock solution*

            1. To 750 ml of ddH2O add:
              • 242 g Tris base
              • 57.1 ml of glacial acetic acid
              • 100 ml of 0.5 M EDTA pH 8.0
            2. Add ddH2O to 1000 ml and mix well on a stir plate.
            3. Store at room temperature.

            Footnote

            *TAE stock solution should be diluted to 1X in H2O before use.

            TBE (Tris/borate/EDTA) electrophoresis buffer, 10X stock solution*

            1. To 900 ml of ddH2O add:
              • 108 g Tris base (890 mM)
              • 55 g boric acid (890 mM)
              • 40 ml 0.5 M EDTA, pH 8.0 (20 mM)
            2. Add ddH2O to 1000 ml and mix well on a stir plate.
            3. Store at room temperature.

            Footnote

            *TBE stock solution should be diluted to 0.5X in H2O before use.

            1. 0.25% bromophenol blue
            2. 0.25% xylene cyanol FF
            3. 40% (w/v) sucrose in water
            4. Store at 4°C.
            1. 0.25% bromophenol blue
            2. 0.25% xylene cyanol FF
            3. 30% glycerol in water
            4. Store at 4°C.
            1. Add 2 g of electrophoresis-grade agarose to 100 ml of 1X TAE or 0.5X TBE buffer in a 250 ml flask or bottle.
            2. Melt the agarose in a microwave until the agarose is fully melted and the solution is clear. Swirl the flask a few times while microwaving to avoid boiling and spilling over.
            3. Cool to 55-60°C and then add 5 µl EtBr for a final concentration of 0.5 µg/ml.
              • EtBr is a powerful carcinogen and must be handled with care.

            Primer working stock solution

            The primer working stock solution should be 20 µM.

            Prior to beginning the PCR, plan the experiment by filling out and printing a plate template worksheet. Also, be sure sufficient quantities of primer working solutions to be used are available.

            1. Remove DNA templates and positive control DNAs from -20°C to the DNA addition area to allow them to thaw completely.
            2. In the PCR reaction assembly area, gather reagents needed for the PCR reactions, including PCR master mix, primers, and PCR grade water. If the reagents are stored at -20°C, allow them to thaw completely and vortex or flick each tube before use.
            3. Sequential multiplex PCR reactions, based on one of the described schemes, are prepared in standard 25 µl reaction volumes using primers and concentrations described in Table 5.
            4. Each PCR reaction should contain:
              • 200 µM (each) of deoxynucleoside triphosphates (dNTPs)
              • 3.5 mM MgCl2
              • 2 Units Taq DNA polymerase
              • Forward primer (Table 5)
              • Reverse primer (Table 5)
              • 2.5 µl of DNA template from isolates (use 5 µl for clinical specimens)
              • PCR-grade water to 25 µl
            5. A master mix can be prepared, which includes all components listed above except DNA template. When calculating volumes of master mix reagents, remember to add enough master mix reagents for 2 extra reactions than the number of specimens there are to be tested to ensure there will be enough master mix.
            6. Pipette 22.5 µl of this master mix into each appropriate well of 96-well plate, according to your plate template worksheet.
            7. Cover the wells of the plate using cap strips. Spray down the clean workspace with 10% bleach (10:1 water: concentrated bleach), and wipe. Repeat with 70% alcohol. Remove laboratory coat and gloves. Put on a fresh pair of gloves. Carefully transport the 96-well plate to the DNA addition area.
            8. Put on new laboratory coat and keep the same pair of gloves on. Remove the cap strips from the plate. Add 2.5 µl of template DNA to each appropriate well of 96-well plate, according to your plate template worksheet.
            9. At least one negative and one positive control should be set up for each serotype per PCR run.
              • Negative control: add 2.5 µl DNA resolving buffer to a reaction well instead of DNA template.
              • Positive control: add 2.5 µl of DNA template that is known to contain the amplified sequence to a reaction well.
            10. Cap columns of wells as you go. Use the roller tool to secure caps tightly.
            11. Wipe down the dirty workspace with 10% bleach, then 70% ethanol. Remove laboratory coat and gloves. If possible, quickly spin the plate at 1000 rpm to bring down any droplets. Transport plate directly to and place it in the PCR thermocycler.
            12. The following PCR conditions are used:
              • 1 cycle of 94°C for 4 minutes
              • 30 cycles of 94°C for 45 seconds 54°C for 45 seconds and 72°C for 2 minutes
              • 1 cycle of 72°C for 2 minutes
            13. Current methodologies are detailed at the CDC website

            Analysis of PCR products on an agarose gel

            PCR products (10 µl) are run on 2% agarose gels to determine band sizes using positive controls. A positive control for each serotype and a 50 bp ladder molecular size marker should be included on each gel.

              Melt the 2% agarose gel in a microwave oven. Cool the agar to approximately 55°C. Add ethidium bromide or other gel stain. Pour into a gel casting cassette, insert the comb, and allow time for hardening (

            Band sizes on agarose gelsmust match those of positive controls before assigning a putative serotype (Figure 5). PCR reactions are setup sequentially and will include those serotypes most frequently determined for each of the schemes. For example, if a strain is negative for any of the serotypes included in reaction 1 then proceed to reaction 2 and so forth until a serotype is determined. If all reactions are completed for a specific scheme and no serotype bands were identified that matched any of the positive controls then the strain may be a nontypeable or one of the serotypes not yet included in the scheme and would need to be further typed using the Quellung reaction (see Chapter 8: Identification and Characterization of Streptococcus pneumoniae). Resolution of individual serotypes within some of the positive reactions could be applicable in some circumstances. For example, to further resolve a PCR positive reaction for 12F/12A/44/46 (reaction 3 in Table 6), perform a Quellung reaction using type-specific antisera to determine whether the strain has a 12F, 12A, 44, or 46 capsular type. It must be mentioned that for practical reasons this is usually not necessary. For example, serotype 12F is commonly detected in disease and carriage specimens, while serotypes 12A, 44, and 46 are extremely rare.

            The positive pneumococcal control band for cpsA can be negative in 1-2% of PCR-serotypeable isolates. This is most often encountered in serotypes 25 and 38, but has also rarely been found for serotypes 14 and 35A. Although a cpsA negative result is relatively rare, at present a negative cpsA does not necessarily equate to a non-serotypeable isolate or a pneumococcus-negative clinical specimen.

            A positive control for each serotype included in the PCR reaction(s) should be run on each gel to ensure that bands are assigned to the correct serotype.

            Table 2. Primers and probes used for detection of bacterial meningitis pathogens

            Table 2. Primers and probes used for detection of bacterial meningitis pathogens
            Target Primer or Probe Name Real-time Primers and Probes Nucleotide Sequence (5&prime to 3&prime) Working Stock Conc (µM) Final Conc (nM) Suggested Probe Modifications
            N. meningitidis
            ctrA F753 TGTGTTCCGCTATACGCCATT 3.75 300
            R846 GCCATATTCACACGATATACC 11.25 900
            Pb820i AACCTTGAGCAA&rdquoT&rdquoCCATTTA
            TCCTGACGTTCT
            1.25 100 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6
            sodC F351 GCACACTTAGGTGATT
            TACCTGCAT
            3.75 300
            R478 CCACCCGTGTGGATCATAATAGA 7.5 600
            Pb387 CATGATGGCACAGCAACAAA
            TCCTGTTT
            1.25 100 5&prime FAM, 3&prime BHQ1
            H. influenzae
            hpd hpdF822 GGTTAAATATGCCGATGGTGTTG 1.25 100
            hpdR952 TGCATCTTTACGCACGGTGTA 3.75 300
            Pb896i TTGTGTACACTCCGT&rdquoT&rdquoGGT
            AAAAGAACTTGCAC
            1.25 100 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6
            S. pneumoniae
            lytA F373 ACGCAATCTAGCAGATGAAGCA 2.5 200
            R424 TCGTGCGTTTTAATTCCAGCT 2.5 200
            Pb400i TGCCGAAAACGC&rdquoT&rdquoTGATAC
            AGGGAG
            2.5 200 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6
            Human DNA
            RNAaseP RNAsePF CCA AGT GTG AGG GCT GAA AAG 4 400
            RNAsePR TGT TGT GGC TGA TGA
            ACT ATA AAA GG
            4 400
            RNAsePPb CCC CAG TCT CTG TCA GCA
            CTC CCT TC
            1 100 5&prime FAM, 3&prime BHQ1

            Table 3. Primers and probes used for detection of the serogroups of N. meningitidis

            Table 3. Primers and probes used for detection of the serogroups of N. meningitidis
            Target Primer or Probe Name Real-time Primers and Probes Nucleotide Sequence (5&prime to 3&prime) Working Stock Conc (µM) Final Conc (nM) Suggested Probe Modifications
            Nm A F2531 AAAATTCAATGGGTATATCACGAAGA 3.75 300
            sacB R2624 ATATGGTGCAAGCTGGTTTCAATAG 11.25 900
            Pb2591i CTAAAAG&rdquoT&rdquoAGGAAGGGCACT
            TTGTGGCATAAT
            1.25 100 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6
            Nm B F737 GCTACCCCATTTCAGATGATTTGT 3.75 300
            synD R882 ACCAGCCGAGGGTTTATTTCTAC 3.75 300
            Pb839i AAGAGATGGGYAACAAC&rdquoT&rdquoATGT
            AATGTCTTTATTT
            1.25 100 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6
            Nm C F478 CCCTGAGTATGCGAAAAAAATT 11.25 900
            synE R551 TGCTAATCCCGCCTGAATG 3.75 300
            Pb495i TTTCAATGC&rdquoT&rdquoAATGAATACCAC
            CGTTTTTTTGC
            1.25 100 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6
            Nm W135 F857 TATTTATGGAAGGCATGGTGTATG 1.25 100
            synG R964 TTGCCATTCCAGAAATATCACC 11.25 900
            Pb907i AAATATGGAGCGAATGATTACAGT
            AACTATAATGAA
            2.5 200 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6
            Nm X F173 TGTCCCCAACCGTTTATTGG 11.25 900
            xcbB R237 TGCTGCTATCATAGCCGCC 11.25 900
            Pb196 TGTTTGCCCACATGAATGGCGG 1.25 100 5&prime FAM, 3&prime BHQ1
            Nm Y F787 TCCGAGCAGGAAATTTATGAGAATAC 11.25 900
            synF R929 TTGCTAAAATCATTCGCTCCATAT 7.5 600
            Pb1099i TATGGTG&rdquoT&rdquoACGATATCCCTATCC
            TTGCCTATAAT
            1.25 100 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6

            Table 4. Primers and probes used for detection of the serotypes of H. influenzae

            Table 4. Primers and probes used for detection of the serotypes of H. influenzae
            Target Primer or Probe Name Real-time Primers and Probes Nucleotide Sequence (5&prime to 3&prime) Working Stock Conc (µM) Final Conc (nM) Suggested Probe Modifications
            Hi a F261 GGT CTG CGG TGT CCT GTG T 1.25 100
            acsB R427 CCG GTC ATC TTT TAT GCT CCA A 3.75 300
            Pb375i TAA TTT TCT TGC &ldquoT&rdquoCA ATA CCG CCT TCC CA 1.25 100 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6
            Hi b F192 TGA TGC ATT GAA AGA AGG TGT AAT TT 3.75 300
            bcsB R359 CCT GCG GTA ATA ACA TGA TCA TAA A 7.5 600
            Pb244i TGT CGT GCA G&rdquoT&rdquoA GCA AAC CGT AAC CTT ACT C 1.25 100 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6
            Hi c F7667 CAT TGG TGA TGG TTC AGT TAT TGG 7.5 600
            ccsD R7784 TAC AGC ATT CAG CAA TAA TGG G 3.75 300
            Pb7726i ATT GCA &ldquoT&rdquoCG CCG CAG GAG TTC CCG 2.5 200 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6
            Hi d F2211 CCT AAA ATA CGG ACC TAG TGC AC 7.5 600
            dcsE R2255 CCG ATG AGA CCA AGT ATG GTT A 1.25 100
            Pb2221i AAC GAG C&rdquoT&rdquoA GAG CTG GTG CTG AA 3.75 300 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6
            Hi e F1523 ACT AAA ATA TGG CCC AAA CCC AC 7.5 600
            ecsH R1589 CCG ATG AGC CCA AGT ATG ATG A 7.5 600
            Pb1555i AAC GAG CAA AAG CCG G&rdquoT&rdquoG CGG AT 2.5 200 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6
            Hi f F7164 CCC TGA AAA GCG TTG ACT TTG 7.5 600
            bexD R7313 CCA ACT TCA GGA CCA AGT CAT TC 3.75 300
            Pb7242i TGC TGC TAA C&rdquoT&rdquoC AGA TGC ATC AGC TCC TT 2.5 200 5&prime FAM, BHQ1 on &ldquoT&rdquo, 3&prime SpC6

            Table 5. List of primers used for pneumococcal serotype deduction. Please note that this website should be used as the primary source of primer sequences and protocols due to periodic introduced improvements.

            *All serotypes that are co-detected are listed

            Table 5. List of primers used for pneumococcal serotype deduction.
            Target Primer or Probe Name Real-time Primers and Probes Nucleotide Sequence (5&prime to 3&prime) Working Stock Conc (µM) Final Conc (nM)
            1-f CTC TAT AGA ATG GAG TAT ATA AAC TAT GGT TA wzy 0.3 280
            1-r CCA AAG AAA ATA CTA ACA TTA TCA CAA TAT TGG C 0.3
            2-f TAT CCC AGT TCA ATA TTT CTC CAC TAC ACC wzy 0.3 290
            2-r ACA CAA AAT ATA GGC AGA GAG AGA CTA CT 0.3
            3-f ATG GTG TGA TTT CTC CTA GAT TGG AAA GTA G galU 0.3 371
            3-r CTT CTC CAA TTG CTT ACC AAG TGC AAT AAC G 0.3
            4-f a CTG TTA CTT GTT CTG GAC TCT CGA TAA TTG G wzy 0.3 430
            4-r GCC CAC TCC TGT TAA AAT CCT ACC CGC ATT G 0.3
            5-f ATA CCT ACA CAA CTT CTG ATT ATG CCT TTG TG wzy 0.3 362
            5-r GCT CGA TAA ACA TAA TCA ATA TTT GAA AAA GTA TG 0.3
            6A/6B/6C/6D -f AAT TTG TAT TTT ATT CAT GCC TAT ATC TGG wciP 0.3 250
            6A/6B/6C/6D -r TTA GCG GAG ATA ATT TAA AAT GAT GAC TA 0.3
            6C/6D -f CAT TTT AGT GAA GTT GGC GGT GGA GTT wciNbeta 0.5 727
            6C/6D -r AGC TTC GAA GCC CAT ACT CTT CAA TTA 0.5
            7C/(7B/40)-f CTA TCT CAG TCA TCT ATT GTT AAA GTT TAC GAC GGG A wcwL 0.3 260
            7C/(7B/40)-r GAA CAT AGA TGT TGA GAC ATC TTT TGT AAT TTC 0.3
            7F/7A-f TCC AAA CTA TTA CAG TGG GAA TTA CGG wzy 0.4 599
            7F/7A-r ATA GGA ATT GAG ATT GCC AAA GCG AC 0.4
            8-f GAA GAA ACG AAA CTG TCA GAG CAT TTA CAT wzy 0.2 201
            8-r CTA TAG ATA CTA GTA GAG CTG TTC TAG TCT 0.2
            9N/9L-f GAA CTG AAT AAG TCA GAT TTA ATC AGC wzx 0.5 516
            9N/9L-r ACC AAG ATC TGA CGG GCT AAT CAA T 0.5
            9V/9A-f GGG TTC AAA G TC AGA CAG TG A ATC TTA A wzy 0.5 816
            9V/9A-r CCA TGA ATG A AA TCA ACA TT G TCA GTA GC 0.5
            10A-f GGT GTA GAT TTA CCA TTA GTG TCG GCA GAC wcrG 0.5 628
            10A-r GAA TTT CTT CTT TAA GAT TCG GAT ATT TCT C 0.5
            10F/(10C/33C)- f GGA GTT TAT CGG TAG TGC TCA TTT TAG CA wzx 0.3 248
            10F/(10C/33C)-r CTA ACA AAT TCG CAA CAC GAG GCA ACA 0.3
            11A/11D-f GGA CAT GTT CAG GTG ATT TCC CAA TAT AGT G wzy 0.3 463
            11A/11D-r GAT TAT GAG TGT AAT TTA TTC CAA CTT CTC CC 0.3
            12F/(12A/44/46)-f GCA ACA AAC GGC GTG AAA GTA GTT G wzx 0.5 376
            12F/(12A/44/46)-r CAA GAT GAA TAT CAC TAC CAA TAA CAA AAC 0.5
            13-f TAC TAA GGT AAT CTC TGG AAA TCG AAA GG wzx 0.4 655
            13-r CTC ATG CAT TTT ATT AAC CG C TTT TTG TTC 0.4
            14-f GAA ATG TTA CTT GGC GCA GGT GTC AGA ATT wzy 0.3 189
            14-r GCC AAT ACT TCT TAG TCT CTC AGA TGA AT 0.3
            15A/15F-f ATT AGT ACA GCT GCT GGA ATA TCT CTT C wzy 0.3 434
            15A/15F-r GAT CTA GTG AAC GTA CTA TTC CAA AC 0.3
            15B/15C-f TTG GAA TTT TTT AAT TAG TGG CTT ACC TA wzy 0.3 496
            15B/15C-r CAT CCG CTT ATT AAT TGA AGT AAT CTG AAC C 0.3
            16F-f, GAA TTT TTC AGG CGT GGG TGT TAA AAG wzy 0.4 717
            16F-r CAG CAT ATA GCA CCG CTA AGC AAA TA 0.4
            17F-f TTC GTG ATG ATA ATT CCA ATG ATC AAA CAA GAG wciP 0.5 693
            17F-r GAT GTA ACA AAT TTG TAG CGA CTA AGG TCT GC 0.5
            18/(18A/18B/18C/18F)-f CTT AAT AGC TCT CAT TAT TCT TTT TTT AAG CC wzy 0.3 573
            18/(18A/18B/18C/18F)-r TTA TCT GTA AAC CAT ATC AGC ATC TGA AAC 0.3
            19A-f GAG AGA TTC ATA ATC TTG CAC TTA GCC A wzy 0.3 566
            19A-r CAT AAT AGC TAC AAA TGA CTC ATC GCC 0.3
            19F-f GTT AAG ATT GCT GAT CGA TTA ATT GAT ATC C wzy 0.5 304
            19F-r GTA ATA TGT CTT TAG GGC GTT TAT GGC GAT AG 0.5
            20-f GAG CAA GAG TTT TTC ACC TGA CAG CGA GAA G wciL 0.3 514
            20-r CTA AAT TCC TGT AAT TTA GCT AAA ACT CTT ATC 0.3
            21-f CTA TGG TTA TTT CAA CTC AAT CGT CAC C wzx 0.2 192
            21-r GGC AAA CTC AGA CAT AGT ATA GCA TAG 0.2
            22F/22A-f GAG TAT AGC CAG ATT ATG GCA GTT TTA TTG TC wcwV 0.5 643
            22F/22A-r CTC CAG CAC TTG CGC TGG AAA CAA CAG ACA AC 0.5
            23A-f TAT TCT AGC AAG TGA CGA AGA TGC G wzy 0.5 722
            23A-r CCA ACA TGC TTA AAA ACG CTG CTT TAC 0.5
            23B-f CCA CAA TTA G CG CTA TAT TCA TTC AAT CG wzx 0.2 199
            23B-r GTC CAC GCT GAA TAA AAT GAA GCT CCG 0.2
            23F-f a GTA ACA GTT GCT GTA GAG GGA ATT GGC TTT TC wzy 0.5 384
            23F-r CAC AAC ACC TAA CAC TCG ATG GCT ATA TGA TTC 0.5
            24A/24B/24F-f GCT CCC TGC TAT TGT AAT CTT TAA AGA G wzy 0.2 99
            24A/24B/24F-r GTG TCT TTT ATT GAC TTT ATC ATA GGT CGG 0.2
            31-f GGA AGT TTT CAA GGA TAT GAT AGT GGT GGT GC wzy 0.5 701
            31-r CCG AAT AAT ATA TTC AAT ATA TTC CTA CTC 0.5
            33F/33A/37-f GAA GGC AAT CAA TGT GAT TGT GTC GCG wzy 0.3 338
            33F/33A/37-r CTT CAA AAT GAA GAT TAT AGT ACC CTT CTA C 0.3
            34-f GCT TTT GTA AGA GGA GAT TAT TTT CAC CCA AC wzy 0.3 408
            34-r CAA TCC GAC TAA GTC TTC AGT AAA AAA CTT TAC 0.3
            35A/35C/42-f ATT ACG ACT CCT TAT GTG ACG CGC ATA wzx 0.3 280
            35A/35C/42-r CCA ATC CCA AGA TAT ATG CAA CTA GGT T 0.3
            35B-f GAT AAG TCT GTT GTG GAG ACT TAA AAA GAA TG wcrH 0.5 677
            35B-r CTT TCC AGA TAA TTA CAG GTA TTC CTG AAG CAA G 0.5
            35F/47F-f GAA CAT AGT CGC TAT TGT ATT TTA TTT AAA GCA A wzy 0.3 517
            35F/47F-r GAC TAG GAG CAT TAT TCC TAG AGC GAG TAA ACC 0.3
            38/25F-f CGT TCT TTT ATC TCA CTG TAT AGT ATC TTT ATG wzy 0.3 574
            38/25F-r ATG TTT GAA TTA AAG CTA ACG TAA CAA TCC 0.3
            39-f TCA TTG TAT TAA CCC TAT GCT TTA TTG GTG wzy 0.2 98
            39-r GAG TAT CTC CAT TGT ATT GAA ATC TAC CAA 0.2
            cpsA-f GCA GTA CAG CAG TTT GTT GGA CTG ACC wzg 0.1 160
            cpsA-r GAA TAT TTT CAT TAT CAG TCC CAG TC 0.1

            Table 6. PCR-serotyping scheme for USA based on current serotype prevalence

            Table 6. PCR-serotyping scheme for USA based on current serotype prevalence
            Reaction Serotypes included
            1 6A/6B/6C/6D, 3, 19A, 22F/22A, 16F
            2 8, 33F/33A/37, 15A/15F, 7F/7A, 23A
            3 19F, 12F/12A/44/46, 11A/11D, 38, 35B
            4 24A/24B/24F, 7C/7B/40, 4, 18A/18B/18C/18F, 9V/9A
            5 14, 1, 23F, 15B/15C, 10A
            6 39, 10F/10C/33C, 5, 35F/47F, 17F
            7 23B, 35A/35C/42, 34, 9N/9L, 31
            8* 6A/6B/6C/6D, 6C/6D

            *Only performed if PCR-positive for 6A/6B/6C/6D in reaction 1

            Table 7. PCR-serotyping scheme for Africa based on current serotype prevalence

            Table 7. PCR-serotyping scheme for Africa based on current serotype prevalence
            Reaction Serotypes included
            1 14, 1, 5, 4, 18A/18B/18C/18F
            2 6A/6B/6C/6D, 19F, 23F, 38/25F, 9V/9A
            3 7C/7B/40, 3, 15B/15C, 7F/7A, 17F
            4 8, 12F/12A/44/46, 9L/9N, 22F/22A, 23A
            5 24A/24B/24F, 2, 11A/11D, 19A, 16F
            6 21, 33F/33A/37, 15A/15F, 35F/47F, 13
            7 39, 23B, 35A/35C/42, 20, 35B
            8 10F/10C/33C, 34, 10A, 31
            9* 6A/6B/6C/6D, 6C/6D

            *Only performed if PCR-positive for 6A/6B/6C/6D in reaction 2

            Table 8. PCR-serotyping scheme for Latin America based on current serotype prevalence



Comments:

  1. Lud

    In my opinion you are not right. Enter we'll discuss. Write to me in PM, we will handle it.

  2. Anh Dung

    This answer, incomparably

  3. Parrish

    Author, what city are you from?

  4. Votilar

    I can't join the discussion right now - very busy. Osvobozhus - necessarily their observations.

  5. Yozshuhn

    Remarkable phrase and it is duly

  6. Reno

    I am assured, that you have deceived.



Write a message